EMAIL THIS PAGE TO A FRIEND

PRSS36

protease, serine, 36

96 Gene Product Result for
UniProtKB ID: Q5K4E3, A8K2P5, B4DW80, B7ZMK8, E7EX56, Q8NBY4
Gene ID:
Mouse(77613) protease, serine, 36
Rat(497040) protease, serine, 36
dog(489924) protease, serine, 36
Horse(100064863) protease, serine, 36
domestic cat(101082366) protease, serine, 36
Domestic Rabbit(100352620) protease, serine, 36
naked mole-rat(101705953) protease, serine, 36
domestic guinea pig(100733736) protease, serine, 36
cow(100847781) protease, serine, 36
sheep(101106230) protease, serine, 36
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173502 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_486010 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_486010 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_486010 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154831 MISSION® esiRNA esiRNA human PRSS36 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173502 Rosetta Predictions human pricing
NM_001011560 Rosetta Predictions rat pricing
NM_001081374 Rosetta Predictions mouse pricing
XM_001004440 Rosetta Predictions mouse pricing
XM_620569 Rosetta Predictions mouse pricing
XM_902328 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061870 predicted 283
2 SASI_Hs01_00061871 predicted 1936
3 SASI_Hs01_00061872 predicted 2439
4 SASI_Hs01_00061873 predicted 1851
5 SASI_Hs01_00061874 predicted 1045
6 SASI_Hs01_00061875 predicted 1616
7 SASI_Hs02_00368271 predicted 1746
8 SASI_Hs01_00061876 predicted 674
9 SASI_Hs01_00061877 predicted 2402
10 SASI_Hs01_00061878 predicted 818
11 SASI_Hs01_00061879 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199846 predicted 1879
2 SASI_Rn01_00071907 predicted 1561
3 SASI_Rn01_00071908 predicted 1636
4 SASI_Rn01_00071909 predicted 2324
5 SASI_Rn01_00071910 predicted 1779
6 SASI_Rn01_00071911 predicted 2034
7 SASI_Rn01_00071912 predicted 2268
8 SASI_Rn01_00071913 predicted 1114
9 SASI_Rn01_00071914 predicted 826
10 SASI_Rn01_00071916 predicted 1784
11 SASI_Rn01_00071915 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297791 predicted 2119
2 SASI_Mm02_00297792 predicted 1878
3 SASI_Mm02_00297793 predicted 2023
4 SASI_Mm02_00297794 predicted 1229
5 SASI_Mm02_00297795 predicted 2267
6 SASI_Mm02_00297796 predicted 2503
7 SASI_Mm02_00297797 predicted 1037
8 SASI_Mm02_00297798 predicted 1800
9 SASI_Mm02_00297799 predicted 1045
10 SASI_Mm02_00297800 predicted 2034
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243430 predicted 535
2 SASI_Mm01_00243431 predicted 697
3 SASI_Mm01_00243432 predicted 782
4 SASI_Mm01_00243433 predicted 568
5 SASI_Mm01_00243434 predicted 815
6 SASI_Mm01_00243435 predicted 842
7 SASI_Mm01_00243436 predicted 641
8 SASI_Mm01_00243437 predicted 721
9 SASI_Mm01_00243438 predicted 732
10 SASI_Mm01_00243439 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215952 predicted 1983
2 SASI_Mm01_00215953 predicted 1850
3 SASI_Mm01_00215954 predicted 2542
4 SASI_Mm01_00215955 predicted 2239
5 SASI_Mm01_00215956 predicted 2481
6 SASI_Mm01_00215957 predicted 1326
7 SASI_Mm01_00215958 predicted 1046
8 SASI_Mm01_00215959 predicted 1778
9 SASI_Mm01_00215960 predicted 1054
10 SASI_Mm01_00215961 predicted 1999
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203634 predicted 2018
2 SASI_Mm01_00203635 predicted 1890
3 SASI_Mm01_00203636 predicted 2572
4 SASI_Mm01_00203637 predicted 2281
5 SASI_Mm01_00203638 predicted 2514
6 SASI_Mm01_00203639 predicted 1320
7 SASI_Mm01_00203640 predicted 1046
8 SASI_Mm01_00203641 predicted 1813
9 SASI_Mm01_00203642 predicted 1056
10 SASI_Mm01_00203643 predicted 2031
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173502
PRSS36 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 36
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173502.3-316s21c1
Sequence:CCGGCTCACTGTTTCATGACGAATGCTCGAGCATTCGTCATGAAACAGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173502.3-1644s21c1
Sequence:CCGGGACTTTCCCAGTGGCTGTCTACTCGAGTAGACAGCCACTGGGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173502.3-1776s21c1
Sequence:CCGGGAGACTGAGACACAGACTTGTCTCGAGACAAGTCTGTGTCTCAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-2235s1c1
Sequence:CCGGCGAATCTGTGACTGCCTCTATCTCGAGATAGAGGCAGTCACAGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-2219s1c1
Sequence:CCGGCTCCATCTTGACACAACGAATCTCGAGATTCGTTGTGTCAAGATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-800s1c1
Sequence:CCGGCCAGGCAGGAATCACCAGCTTCTCGAGAAGCTGGTGATTCCTGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-679s1c1
Sequence:CCGGTCAACCTCACTCTCCAGATATCTCGAGATATCTGGAGAGTGAGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-1950s1c1
Sequence:CCGGGTGCCTTACATTGAAGTGTATCTCGAGATACACTTCAATGTAAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173502
PRSS36 MISSION shRNA shRNA Plasmid DNA
protease, serine, 36
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173502.3-316s21c1
Sequence:CCGGCTCACTGTTTCATGACGAATGCTCGAGCATTCGTCATGAAACAGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173502.3-1644s21c1
Sequence:CCGGGACTTTCCCAGTGGCTGTCTACTCGAGTAGACAGCCACTGGGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173502.3-1776s21c1
Sequence:CCGGGAGACTGAGACACAGACTTGTCTCGAGACAAGTCTGTGTCTCAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-2235s1c1
Sequence:CCGGCGAATCTGTGACTGCCTCTATCTCGAGATAGAGGCAGTCACAGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-2219s1c1
Sequence:CCGGCTCCATCTTGACACAACGAATCTCGAGATTCGTTGTGTCAAGATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-800s1c1
Sequence:CCGGCCAGGCAGGAATCACCAGCTTCTCGAGAAGCTGGTGATTCCTGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-679s1c1
Sequence:CCGGTCAACCTCACTCTCCAGATATCTCGAGATATCTGGAGAGTGAGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-1950s1c1
Sequence:CCGGGTGCCTTACATTGAAGTGTATCTCGAGATACACTTCAATGTAAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173502
PRSS36 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 36
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173502.3-316s21c1
Sequence:CCGGCTCACTGTTTCATGACGAATGCTCGAGCATTCGTCATGAAACAGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173502.3-1644s21c1
Sequence:CCGGGACTTTCCCAGTGGCTGTCTACTCGAGTAGACAGCCACTGGGAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173502.3-1776s21c1
Sequence:CCGGGAGACTGAGACACAGACTTGTCTCGAGACAAGTCTGTGTCTCAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-2235s1c1
Sequence:CCGGCGAATCTGTGACTGCCTCTATCTCGAGATAGAGGCAGTCACAGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-2219s1c1
Sequence:CCGGCTCCATCTTGACACAACGAATCTCGAGATTCGTTGTGTCAAGATGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-800s1c1
Sequence:CCGGCCAGGCAGGAATCACCAGCTTCTCGAGAAGCTGGTGATTCCTGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-679s1c1
Sequence:CCGGTCAACCTCACTCTCCAGATATCTCGAGATATCTGGAGAGTGAGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173502.1-1950s1c1
Sequence:CCGGGTGCCTTACATTGAAGTGTATCTCGAGATACACTTCAATGTAAGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_486010
PRSS36 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 36
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-484s1c1
Sequence:CCGGCGGGCCTATGTTGGAAAGATTCTCGAGAATCTTTCCAACATAGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-958s1c1
Sequence:CCGGGCCCTGAAGCTACATGGATATCTCGAGATATCCATGTAGCTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-176s1c1
Sequence:CCGGCGAGAACGCTTCCAGGGACTTCTCGAGAAGTCCCTGGAAGCGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-717s1c1
Sequence:CCGGACACATACTGAGCACGGTGTTCTCGAGAACACCGTGCTCAGTATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-446s1c1
Sequence:CCGGGCACTTGCTTTGTCCCGCCTACTCGAGTAGGCGGGACAAAGCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_486010
PRSS36 MISSION shRNA shRNA Plasmid DNA
protease, serine, 36
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-484s1c1
Sequence:CCGGCGGGCCTATGTTGGAAAGATTCTCGAGAATCTTTCCAACATAGGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-958s1c1
Sequence:CCGGGCCCTGAAGCTACATGGATATCTCGAGATATCCATGTAGCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-176s1c1
Sequence:CCGGCGAGAACGCTTCCAGGGACTTCTCGAGAAGTCCCTGGAAGCGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-717s1c1
Sequence:CCGGACACATACTGAGCACGGTGTTCTCGAGAACACCGTGCTCAGTATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-446s1c1
Sequence:CCGGGCACTTGCTTTGTCCCGCCTACTCGAGTAGGCGGGACAAAGCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_486010
PRSS36 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 36
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-484s1c1
Sequence:CCGGCGGGCCTATGTTGGAAAGATTCTCGAGAATCTTTCCAACATAGGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-958s1c1
Sequence:CCGGGCCCTGAAGCTACATGGATATCTCGAGATATCCATGTAGCTTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-176s1c1
Sequence:CCGGCGAGAACGCTTCCAGGGACTTCTCGAGAAGTCCCTGGAAGCGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-717s1c1
Sequence:CCGGACACATACTGAGCACGGTGTTCTCGAGAACACCGTGCTCAGTATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486010.2-446s1c1
Sequence:CCGGGCACTTGCTTTGTCCCGCCTACTCGAGTAGGCGGGACAAAGCAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)