EMAIL THIS PAGE TO A FRIEND

PRSS37

protease, serine, 37

46 Gene Product Result for
Synonyms: TRYX2
UniProtKB ID: A4D1T9, B2RPB5
Gene ID:
Mouse(67690) protease, serine, 37
Rat(362346) protease, serine, 37
cow(540062) protease, serine, 37
sheep(101109698) protease, serine, 37
domestic guinea pig(100715821) protease, serine, 37
naked mole-rat(101709024) protease, serine, 37
dog(482761) protease, serine, 37
domestic cat(101083414) protease, serine, 37
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008270 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026317 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026317 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026317 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099791 MISSION® esiRNA esiRNA human AC093638.4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008270 Rosetta Predictions human pricing
NM_001108625 Rosetta Predictions rat pricing
NM_026317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124022 predicted 842
2 SASI_Hs02_00305400 predicted 531
3 SASI_Hs01_00124023 predicted 832
4 SASI_Hs01_00124024 predicted 452
5 SASI_Hs01_00124025 predicted 905
6 SASI_Hs02_00305401 predicted 899
7 SASI_Hs01_00124027 predicted 584
8 SASI_Hs01_00124029 predicted 688
9 SASI_Hs01_00124030 predicted 417
10 SASI_Hs01_00124031 predicted 579
11 SASI_Hs01_00124026 predicted 564
12 SASI_Hs01_00124028 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240479 predicted 570
2 SASI_Rn02_00240480 predicted 547
3 SASI_Rn02_00240481 predicted 305
4 SASI_Rn02_00240482 predicted 828
5 SASI_Rn02_00240483 predicted 508
6 SASI_Rn02_00240484 predicted 608
7 SASI_Rn02_00240485 predicted 259
8 SASI_Rn02_00240486 predicted 279
9 SASI_Rn02_00240487 predicted 591
10 SASI_Rn02_00240488 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094182 predicted 251
2 SASI_Mm01_00094183 predicted 303
3 SASI_Mm01_00094184 predicted 823
4 SASI_Mm01_00094185 predicted 573
5 SASI_Mm01_00094186 predicted 771
6 SASI_Mm01_00094187 predicted 748
7 SASI_Mm01_00094189 predicted 294
8 SASI_Mm01_00094190 predicted 701
9 SASI_Mm01_00094191 predicted 262
10 SASI_Mm02_00330021 predicted 274
11 SASI_Mm01_00094188 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008270
PRSS37 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 37
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-1017s1c1
Sequence:CCGGCGGCATCTACACCAATGTTTACTCGAGTAAACATTGGTGTAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-421s1c1
Sequence:CCGGGCTGACTCATCTGTTCAGAAACTCGAGTTTCTGAACAGATGAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008270.1-689s21c1
Sequence:CCGGCTAAGCCTGCCATGCTCAATCCTCGAGGATTGAGCATGGCAGGCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008270.1-532s21c1
Sequence:CCGGGCTCACTGCTATTTACCAAATCTCGAGATTTGGTAAATAGCAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-839s1c1
Sequence:CCGGCCGTGATGTCTGATCGAGAATCTCGAGATTCTCGATCAGACATCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-594s1c1
Sequence:CCGGCGGTACTGAACAGACAATTAACTCGAGTTAATTGTCTGTTCAGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-631s1c1
Sequence:CCGGCGCTACTGGAACTACAGTCATCTCGAGATGACTGTAGTTCCAGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008270.1-914s21c1
Sequence:CCGGTGAAAGTATTCAGCCGAATTTCTCGAGAAATTCGGCTGAATACTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008270
PRSS37 MISSION shRNA shRNA Plasmid DNA
protease, serine, 37
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-1017s1c1
Sequence:CCGGCGGCATCTACACCAATGTTTACTCGAGTAAACATTGGTGTAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-421s1c1
Sequence:CCGGGCTGACTCATCTGTTCAGAAACTCGAGTTTCTGAACAGATGAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008270.1-689s21c1
Sequence:CCGGCTAAGCCTGCCATGCTCAATCCTCGAGGATTGAGCATGGCAGGCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008270.1-532s21c1
Sequence:CCGGGCTCACTGCTATTTACCAAATCTCGAGATTTGGTAAATAGCAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-839s1c1
Sequence:CCGGCCGTGATGTCTGATCGAGAATCTCGAGATTCTCGATCAGACATCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-594s1c1
Sequence:CCGGCGGTACTGAACAGACAATTAACTCGAGTTAATTGTCTGTTCAGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-631s1c1
Sequence:CCGGCGCTACTGGAACTACAGTCATCTCGAGATGACTGTAGTTCCAGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008270.1-914s21c1
Sequence:CCGGTGAAAGTATTCAGCCGAATTTCTCGAGAAATTCGGCTGAATACTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008270
PRSS37 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 37
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-1017s1c1
Sequence:CCGGCGGCATCTACACCAATGTTTACTCGAGTAAACATTGGTGTAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-421s1c1
Sequence:CCGGGCTGACTCATCTGTTCAGAAACTCGAGTTTCTGAACAGATGAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008270.1-689s21c1
Sequence:CCGGCTAAGCCTGCCATGCTCAATCCTCGAGGATTGAGCATGGCAGGCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008270.1-532s21c1
Sequence:CCGGGCTCACTGCTATTTACCAAATCTCGAGATTTGGTAAATAGCAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-839s1c1
Sequence:CCGGCCGTGATGTCTGATCGAGAATCTCGAGATTCTCGATCAGACATCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-594s1c1
Sequence:CCGGCGGTACTGAACAGACAATTAACTCGAGTTAATTGTCTGTTCAGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008270.1-631s1c1
Sequence:CCGGCGCTACTGGAACTACAGTCATCTCGAGATGACTGTAGTTCCAGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008270.1-914s21c1
Sequence:CCGGTGAAAGTATTCAGCCGAATTTCTCGAGAAATTCGGCTGAATACTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026317
PRSS37 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 37
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-741s1c1
Sequence:CCGGGCAGCCACAGAAACTCCTTATCTCGAGATAAGGAGTTTCTGTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-874s1c1
Sequence:CCGGCGTTGGCATCTATACCAACATCTCGAGATGTTGGTATAGATGCCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-270s1c1
Sequence:CCGGCAGCTTTAGTCACTCACTCATCTCGAGATGAGTGAGTGACTAAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-463s1c1
Sequence:CCGGGCAGACAATTTATCCCATCCACTCGAGTGGATGGGATAAATTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-481s1c1
Sequence:CCGGCCAGATTATCCGCTACTGGAACTCGAGTTCCAGTAGCGGATAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026317
PRSS37 MISSION shRNA shRNA Plasmid DNA
protease, serine, 37
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-741s1c1
Sequence:CCGGGCAGCCACAGAAACTCCTTATCTCGAGATAAGGAGTTTCTGTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-874s1c1
Sequence:CCGGCGTTGGCATCTATACCAACATCTCGAGATGTTGGTATAGATGCCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-270s1c1
Sequence:CCGGCAGCTTTAGTCACTCACTCATCTCGAGATGAGTGAGTGACTAAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-463s1c1
Sequence:CCGGGCAGACAATTTATCCCATCCACTCGAGTGGATGGGATAAATTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-481s1c1
Sequence:CCGGCCAGATTATCCGCTACTGGAACTCGAGTTCCAGTAGCGGATAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026317
PRSS37 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 37
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-741s1c1
Sequence:CCGGGCAGCCACAGAAACTCCTTATCTCGAGATAAGGAGTTTCTGTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-874s1c1
Sequence:CCGGCGTTGGCATCTATACCAACATCTCGAGATGTTGGTATAGATGCCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-270s1c1
Sequence:CCGGCAGCTTTAGTCACTCACTCATCTCGAGATGAGTGAGTGACTAAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-463s1c1
Sequence:CCGGGCAGACAATTTATCCCATCCACTCGAGTGGATGGGATAAATTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026317.1-481s1c1
Sequence:CCGGCCAGATTATCCGCTACTGGAACTCGAGTTCCAGTAGCGGATAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)