EMAIL THIS PAGE TO A FRIEND

PRSS3

protease, serine, 3

60 Gene Product Result for
Synonyms: MTG PRSS4 T9 TRY3 TRY4
Gene ID:
Human(5646) Summary: This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is expressed in the brain and pancreas and is resistant to common trypsin inhibitors. It is active on peptide linkages involving the carboxyl group of lysine or arginine. This gene is localized to the locus of T cell receptor beta variable orphans on chromosome 9. Four transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2010]
Mouse(22073) protease, serine, 3
Rat(286911) protease, serine, 3
chicken(396345) protease, serine, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002771 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113371 MISSION® esiRNA esiRNA human PRSS3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002771 Rosetta Predictions human pricing
NM_007343 Rosetta Predictions human pricing
NM_173127 Rosetta Predictions rat pricing
NM_011645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082524 predicted 453
2 SASI_Hs01_00082525 predicted 310
3 SASI_Hs02_00334396 predicted 444
4 SASI_Hs02_00334397 predicted 457
5 SASI_Hs02_00334398 predicted 28
6 SASI_Hs02_00334399 predicted 17
7 SASI_Hs01_00082518 predicted 239
8 SASI_Hs01_00082519 predicted 264
9 SASI_Hs01_00082520 predicted 206
10 SASI_Hs01_00082521 predicted 267
11 SASI_Hs01_00082522 predicted 557
12 SASI_Hs01_00082523 predicted 357
13 SASI_Hs01_00082526 predicted 530
14 SASI_Hs01_00082527 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343425 predicted 613
2 SASI_Hs02_00343426 predicted 470
3 SASI_Hs02_00343427 predicted 603
4 SASI_Hs02_00343428 predicted 613
5 SASI_Hs02_00343429 predicted 46
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093253 predicted 308
2 SASI_Rn01_00093254 predicted 316
3 SASI_Rn01_00093255 predicted 458
4 SASI_Rn01_00093256 predicted 310
5 SASI_Rn01_00093257 predicted 295
6 SASI_Rn01_00093258 predicted 526
7 SASI_Rn01_00093259 predicted 406
8 SASI_Rn01_00093260 predicted 527
9 SASI_Rn01_00093261 predicted 438
10 SASI_Rn02_00269295 predicted 492
11 SASI_Rn01_00093262 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047045 predicted 323
2 SASI_Mm01_00047046 predicted 319
3 SASI_Mm01_00047047 predicted 308
4 SASI_Mm01_00047043 predicted 323
5 SASI_Mm01_00047049 predicted 321
6 SASI_Mm02_00321117 predicted 763
7 SASI_Mm02_00321118 predicted 769
8 SASI_Mm02_00321119 predicted 773
9 SASI_Mm02_00321120 predicted 775
10 SASI_Mm01_00047044 predicted 295
11 SASI_Mm01_00047048 predicted 439
12 SASI_Mm01_00047050 predicted 664
13 SASI_Mm01_00047051 predicted 524
14 SASI_Mm01_00047052 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011645
PRSS3 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-306s1c1
Sequence:CCGGGACACTGAACAACGACATTATCTCGAGATAATGTCGTTGTTCAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-51s1c1
Sequence:CCGGCGTGGATGATGATGACAAGATCTCGAGATCTTGTCATCATCATCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-442s1c1
Sequence:CCGGCTTAGCTTTGGTGTCAGTGAACTCGAGTTCACTGACACCAAAGCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-315s1c1
Sequence:CCGGCAACGACATTATGTTGCTCAACTCGAGTTGAGCAACATAATGTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-297s1c1
Sequence:CCGGCAATAGGAAGACACTGAACAACTCGAGTTGTTCAGTGTCTTCCTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011645
PRSS3 MISSION shRNA shRNA Plasmid DNA
protease, serine, 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-306s1c1
Sequence:CCGGGACACTGAACAACGACATTATCTCGAGATAATGTCGTTGTTCAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-51s1c1
Sequence:CCGGCGTGGATGATGATGACAAGATCTCGAGATCTTGTCATCATCATCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-442s1c1
Sequence:CCGGCTTAGCTTTGGTGTCAGTGAACTCGAGTTCACTGACACCAAAGCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-315s1c1
Sequence:CCGGCAACGACATTATGTTGCTCAACTCGAGTTGAGCAACATAATGTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-297s1c1
Sequence:CCGGCAATAGGAAGACACTGAACAACTCGAGTTGTTCAGTGTCTTCCTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011645
PRSS3 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-306s1c1
Sequence:CCGGGACACTGAACAACGACATTATCTCGAGATAATGTCGTTGTTCAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-51s1c1
Sequence:CCGGCGTGGATGATGATGACAAGATCTCGAGATCTTGTCATCATCATCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-442s1c1
Sequence:CCGGCTTAGCTTTGGTGTCAGTGAACTCGAGTTCACTGACACCAAAGCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-315s1c1
Sequence:CCGGCAACGACATTATGTTGCTCAACTCGAGTTGAGCAACATAATGTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011645.1-297s1c1
Sequence:CCGGCAATAGGAAGACACTGAACAACTCGAGTTGTTCAGTGTCTTCCTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002771
VALIDATED
PRSS3 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002771.2-93s1c1
Sequence:CCGGGCTACACCTGTGAGGAGAATTCTCGAGAATTCTCCTCACAGGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002771.2-454s1c1
Sequence:CCGGTCTGAGCTTTGGTGCTGACTACTCGAGTAGTCAGCACCAAAGCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002771.2-619s1c1
Sequence:CCGGCCCTGTGGTCTGCAACGGACACTCGAGTGTCCGTTGCAGACCACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002771.2-302s1c1
Sequence:CCGGCCTAAATACAACAGGGACACTCTCGAGAGTGTCCCTGTTGTATTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002771.2-298s1c1
Sequence:CCGGCCACCCTAAATACAACAGGGACTCGAGTCCCTGTTGTATTTAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002771.3-337s21c1
Sequence:CCGGCATGCTGATCAAACTCTCCTCCTCGAGGAGGAGAGTTTGATCAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002771.3-66s21c1
Sequence:CCGGTTGACGATGATGACAAGATTGCTCGAGCAATCTTGTCATCATCGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002771.3-539s21c1
Sequence:CCGGCCTGGAAAGATTACCAACAGCCTCGAGGCTGTTGGTAATCTTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002771
VALIDATED
PRSS3 MISSION shRNA shRNA Plasmid DNA
protease, serine, 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002771.2-93s1c1
Sequence:CCGGGCTACACCTGTGAGGAGAATTCTCGAGAATTCTCCTCACAGGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002771.2-454s1c1
Sequence:CCGGTCTGAGCTTTGGTGCTGACTACTCGAGTAGTCAGCACCAAAGCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002771.2-619s1c1
Sequence:CCGGCCCTGTGGTCTGCAACGGACACTCGAGTGTCCGTTGCAGACCACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002771.2-302s1c1
Sequence:CCGGCCTAAATACAACAGGGACACTCTCGAGAGTGTCCCTGTTGTATTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002771.2-298s1c1
Sequence:CCGGCCACCCTAAATACAACAGGGACTCGAGTCCCTGTTGTATTTAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002771.3-337s21c1
Sequence:CCGGCATGCTGATCAAACTCTCCTCCTCGAGGAGGAGAGTTTGATCAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002771.3-66s21c1
Sequence:CCGGTTGACGATGATGACAAGATTGCTCGAGCAATCTTGTCATCATCGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002771.3-539s21c1
Sequence:CCGGCCTGGAAAGATTACCAACAGCCTCGAGGCTGTTGGTAATCTTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002771
VALIDATED
PRSS3 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002771.2-93s1c1
Sequence:CCGGGCTACACCTGTGAGGAGAATTCTCGAGAATTCTCCTCACAGGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002771.2-454s1c1
Sequence:CCGGTCTGAGCTTTGGTGCTGACTACTCGAGTAGTCAGCACCAAAGCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002771.2-619s1c1
Sequence:CCGGCCCTGTGGTCTGCAACGGACACTCGAGTGTCCGTTGCAGACCACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002771.2-302s1c1
Sequence:CCGGCCTAAATACAACAGGGACACTCTCGAGAGTGTCCCTGTTGTATTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002771.2-298s1c1
Sequence:CCGGCCACCCTAAATACAACAGGGACTCGAGTCCCTGTTGTATTTAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002771.3-337s21c1
Sequence:CCGGCATGCTGATCAAACTCTCCTCCTCGAGGAGGAGAGTTTGATCAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002771.3-66s21c1
Sequence:CCGGTTGACGATGATGACAAGATTGCTCGAGCAATCTTGTCATCATCGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002771.3-539s21c1
Sequence:CCGGCCTGGAAAGATTACCAACAGCCTCGAGGCTGTTGGTAATCTTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)