EMAIL THIS PAGE TO A FRIEND

PRSS41

protease, serine, 41

31 Gene Product Result for
Synonyms: TESSP1
UniProtKB ID: Q7RTY9
Gene ID:
Mouse(71003) protease, serine, 41
Rat(681033) protease, serine, 41
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301926 ANTI-TESSP1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_128541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_183379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183379 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU017461 MISSION® esiRNA esiRNA targeting mouse 4931440B09Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017785 Rosetta Predictions human pricing
NM_027644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494492 predicted 640
2 SASI_Hs02_00494493 predicted 617
3 SASI_Hs02_00494494 predicted 641
4 SASI_Hs02_00494495 predicted 362
5 SASI_Hs02_00494496 predicted 352
6 SASI_Hs02_00494497 predicted 663
7 SASI_Hs02_00494498 predicted 371
8 SASI_Hs02_00494499 predicted 666
9 SASI_Hs02_00494500 predicted 658
10 SASI_Hs02_00494501 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102915 predicted 598
2 SASI_Mm01_00102916 predicted 856
3 SASI_Mm01_00102917 predicted 397
4 SASI_Mm01_00102918 predicted 298
5 SASI_Mm01_00102919 predicted 352
6 SASI_Mm01_00102920 predicted 713
7 SASI_Mm01_00102921 predicted 831
8 SASI_Mm01_00102922 predicted 342
9 SASI_Mm02_00332527 predicted 290
10 SASI_Mm01_00102923 predicted 880
11 SASI_Mm01_00102924 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128541
PRSS41 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 41
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000033009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128541.1-902s1c1
Sequence:CCGGCGAGACCATGATGATCCTCAACTCGAGTTGAGGATCATCATGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128541.1-881s1c1
Sequence:CCGGCAGCCATTATTACAACTGGATCTCGAGATCCAGTTGTAATAATGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128541.1-431s1c1
Sequence:CCGGCATCGTAAACTCCGAAGACAACTCGAGTTGTCTTCGGAGTTTACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128541.1-621s1c1
Sequence:CCGGCCCTATCACCTTCGAGAAGTACTCGAGTACTTCTCGAAGGTGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128541
PRSS41 MISSION shRNA shRNA Plasmid DNA
protease, serine, 41
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000033009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128541.1-902s1c1
Sequence:CCGGCGAGACCATGATGATCCTCAACTCGAGTTGAGGATCATCATGGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128541.1-881s1c1
Sequence:CCGGCAGCCATTATTACAACTGGATCTCGAGATCCAGTTGTAATAATGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128541.1-431s1c1
Sequence:CCGGCATCGTAAACTCCGAAGACAACTCGAGTTGTCTTCGGAGTTTACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128541.1-621s1c1
Sequence:CCGGCCCTATCACCTTCGAGAAGTACTCGAGTACTTCTCGAAGGTGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128541
PRSS41 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 41
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000033009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128541.1-902s1c1
Sequence:CCGGCGAGACCATGATGATCCTCAACTCGAGTTGAGGATCATCATGGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128541.1-881s1c1
Sequence:CCGGCAGCCATTATTACAACTGGATCTCGAGATCCAGTTGTAATAATGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128541.1-431s1c1
Sequence:CCGGCATCGTAAACTCCGAAGACAACTCGAGTTGTCTTCGGAGTTTACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128541.1-621s1c1
Sequence:CCGGCCCTATCACCTTCGAGAAGTACTCGAGTACTTCTCGAAGGTGATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183379
PRSS41 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 41
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-671s1c1
Sequence:CCGGGCCGTAGTATGATCTGGGATTCTCGAGAATCCCAGATCATACTACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-504s1c1
Sequence:CCGGCGAGTCTTCCACCTTCAACTTCTCGAGAAGTTGAAGGTGGAAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-381s1c1
Sequence:CCGGTCGTTACAAAGTGCAGGACATCTCGAGATGTCCTGCACTTTGTAACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-640s1c1
Sequence:CCGGAGGTGTAATTACCTGTTTGAACTCGAGTTCAAACAGGTAATTACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-592s1c1
Sequence:CCGGCCTCCTTACAACCTCCGGGAACTCGAGTTCCCGGAGGTTGTAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183379
PRSS41 MISSION shRNA shRNA Plasmid DNA
protease, serine, 41
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-671s1c1
Sequence:CCGGGCCGTAGTATGATCTGGGATTCTCGAGAATCCCAGATCATACTACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-504s1c1
Sequence:CCGGCGAGTCTTCCACCTTCAACTTCTCGAGAAGTTGAAGGTGGAAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-381s1c1
Sequence:CCGGTCGTTACAAAGTGCAGGACATCTCGAGATGTCCTGCACTTTGTAACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-640s1c1
Sequence:CCGGAGGTGTAATTACCTGTTTGAACTCGAGTTCAAACAGGTAATTACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-592s1c1
Sequence:CCGGCCTCCTTACAACCTCCGGGAACTCGAGTTCCCGGAGGTTGTAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183379
PRSS41 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 41
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-671s1c1
Sequence:CCGGGCCGTAGTATGATCTGGGATTCTCGAGAATCCCAGATCATACTACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-504s1c1
Sequence:CCGGCGAGTCTTCCACCTTCAACTTCTCGAGAAGTTGAAGGTGGAAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-381s1c1
Sequence:CCGGTCGTTACAAAGTGCAGGACATCTCGAGATGTCCTGCACTTTGTAACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-640s1c1
Sequence:CCGGAGGTGTAATTACCTGTTTGAACTCGAGTTCAAACAGGTAATTACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183379.1-592s1c1
Sequence:CCGGCCTCCTTACAACCTCCGGGAACTCGAGTTCCCGGAGGTTGTAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)