EMAIL THIS PAGE TO A FRIEND

PRSS43

protease, serine, 43

14 Gene Product Result for
Synonyms: TESSP3
Gene ID:
Mouse(272643) protease, serine, 43
cow(517392) protease, serine, 43
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035031 MISSION® esiRNA esiRNA targeting mouse Tessp3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109266 predicted 990
2 SASI_Mm01_00109268 predicted 960
3 SASI_Mm01_00109269 predicted 419
4 SASI_Mm01_00109270 predicted 656
5 SASI_Mm01_00109271 predicted 855
6 SASI_Mm01_00109272 predicted 675
7 SASI_Mm01_00109273 predicted 1425
8 SASI_Mm01_00109274 predicted 1390
9 SASI_Mm01_00109275 predicted 702
10 SASI_Mm02_00351480 predicted 1215
11 SASI_Mm01_00109267 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199471
PRSS43 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 43
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-426s1c1
Sequence:CCGGGCCTTTGTTCAGTGGTACTTACTCGAGTAAGTACCACTGAACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-937s1c1
Sequence:CCGGCCTTCCAACTTTGACATTCAACTCGAGTTGAATGTCAAAGTTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-533s1c1
Sequence:CCGGGTCGCTTGAAATCCCTGAGTACTCGAGTACTCAGGGATTTCAAGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-1212s1c1
Sequence:CCGGCCTAGTGATTAAAGGGATGATCTCGAGATCATCCCTTTAATCACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-1365s1c1
Sequence:CCGGCCTCTCAGTTTACACAGACATCTCGAGATGTCTGTGTAAACTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199471
PRSS43 MISSION shRNA shRNA Plasmid DNA
protease, serine, 43
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-426s1c1
Sequence:CCGGGCCTTTGTTCAGTGGTACTTACTCGAGTAAGTACCACTGAACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-937s1c1
Sequence:CCGGCCTTCCAACTTTGACATTCAACTCGAGTTGAATGTCAAAGTTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-533s1c1
Sequence:CCGGGTCGCTTGAAATCCCTGAGTACTCGAGTACTCAGGGATTTCAAGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-1212s1c1
Sequence:CCGGCCTAGTGATTAAAGGGATGATCTCGAGATCATCCCTTTAATCACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-1365s1c1
Sequence:CCGGCCTCTCAGTTTACACAGACATCTCGAGATGTCTGTGTAAACTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199471
PRSS43 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 43
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-426s1c1
Sequence:CCGGGCCTTTGTTCAGTGGTACTTACTCGAGTAAGTACCACTGAACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-937s1c1
Sequence:CCGGCCTTCCAACTTTGACATTCAACTCGAGTTGAATGTCAAAGTTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-533s1c1
Sequence:CCGGGTCGCTTGAAATCCCTGAGTACTCGAGTACTCAGGGATTTCAAGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-1212s1c1
Sequence:CCGGCCTAGTGATTAAAGGGATGATCTCGAGATCATCCCTTTAATCACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199471.1-1365s1c1
Sequence:CCGGCCTCTCAGTTTACACAGACATCTCGAGATGTCTGTGTAAACTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)