EMAIL THIS PAGE TO A FRIEND

PRSS46

protease, serine, 46

26 Gene Product Result for
Synonyms: TESSP6
UniProtKB ID: E5RG02
Gene ID:
Mouse(74306) protease, serine, 46
Rat(408245) protease, serine, 46
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008865 Rosetta Predictions rat pricing
NM_183103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071937 predicted 448
2 SASI_Rn01_00071938 predicted 191
3 SASI_Rn01_00071939 predicted 338
4 SASI_Rn01_00071941 predicted 332
5 SASI_Rn01_00071942 predicted 372
6 SASI_Rn01_00071943 predicted 374
7 SASI_Rn01_00071944 predicted 260
8 SASI_Rn01_00071945 predicted 267
9 SASI_Rn01_00071946 predicted 437
10 SASI_Rn02_00199392 predicted 262
11 SASI_Rn01_00071940 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175345 predicted 688
2 SASI_Mm01_00175346 predicted 940
3 SASI_Mm01_00175347 predicted 886
4 SASI_Mm01_00175348 predicted 565
5 SASI_Mm01_00175349 predicted 877
6 SASI_Mm02_00350087 predicted 932
7 SASI_Mm01_00175350 predicted 846
8 SASI_Mm01_00175351 predicted 310
9 SASI_Mm01_00175352 predicted 445
10 SASI_Mm01_00175353 predicted 297
11 SASI_Mm01_00175354 predicted 610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183103
PRSS46 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 46
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-498s1c1
Sequence:CCGGCCTCATTCAATTTAAAGCCAACTCGAGTTGGCTTTAAATTGAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-316s1c1
Sequence:CCGGCCCGGCTAAATACACTGTGAACTCGAGTTCACAGTGTATTTAGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-862s1c1
Sequence:CCGGCCAGTGGATCAAGAGACAGATCTCGAGATCTGTCTCTTGATCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-886s1c1
Sequence:CCGGCGACCTGAAGTTTACCAGCATCTCGAGATGCTGGTAAACTTCAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-403s1c1
Sequence:CCGGCGAGAACTTCATCAATCGCATCTCGAGATGCGATTGATGAAGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183103
PRSS46 MISSION shRNA shRNA Plasmid DNA
protease, serine, 46
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-498s1c1
Sequence:CCGGCCTCATTCAATTTAAAGCCAACTCGAGTTGGCTTTAAATTGAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-316s1c1
Sequence:CCGGCCCGGCTAAATACACTGTGAACTCGAGTTCACAGTGTATTTAGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-862s1c1
Sequence:CCGGCCAGTGGATCAAGAGACAGATCTCGAGATCTGTCTCTTGATCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-886s1c1
Sequence:CCGGCGACCTGAAGTTTACCAGCATCTCGAGATGCTGGTAAACTTCAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-403s1c1
Sequence:CCGGCGAGAACTTCATCAATCGCATCTCGAGATGCGATTGATGAAGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183103
PRSS46 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 46
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-498s1c1
Sequence:CCGGCCTCATTCAATTTAAAGCCAACTCGAGTTGGCTTTAAATTGAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-316s1c1
Sequence:CCGGCCCGGCTAAATACACTGTGAACTCGAGTTCACAGTGTATTTAGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-862s1c1
Sequence:CCGGCCAGTGGATCAAGAGACAGATCTCGAGATCTGTCTCTTGATCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-886s1c1
Sequence:CCGGCGACCTGAAGTTTACCAGCATCTCGAGATGCTGGTAAACTTCAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183103.1-403s1c1
Sequence:CCGGCGAGAACTTCATCAATCGCATCTCGAGATGCGATTGATGAAGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)