EMAIL THIS PAGE TO A FRIEND

PRSS50

protease, serine, 50

40 Gene Product Result for
Synonyms: CT20 TSP50
UniProtKB ID: Q9UI38
Gene ID:
Mouse(235631) protease, serine, 50
cow(518845) protease, serine, 50
sheep(101103019) protease, serine, 50
domestic guinea pig(100720816) protease, serine, 50
naked mole-rat(101720460) protease, serine, 50
dog(476646) protease, serine, 50
domestic cat(101094738) protease, serine, 50
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013270 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU027821 MISSION® esiRNA esiRNA targeting mouse Tsp50 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013270 Rosetta Predictions human pricing
NM_146227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344507 predicted 518
2 SASI_Hs01_00180035 predicted 353
3 SASI_Hs02_00344508 predicted 963
4 SASI_Hs01_00180038 predicted 858
5 SASI_Hs01_00180039 predicted 738
6 SASI_Hs01_00180040 predicted 763
7 SASI_Hs01_00180041 predicted 1075
8 SASI_Hs01_00180042 predicted 564
9 SASI_Hs02_00344509 predicted 319
10 SASI_Hs01_00180044 predicted 1020
11 SASI_Hs01_00180036 predicted 316
12 SASI_Hs01_00180037 predicted 703
13 SASI_Hs01_00180043 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070898 predicted 444
2 SASI_Mm01_00070899 predicted 993
3 SASI_Mm01_00070900 predicted 793
4 SASI_Mm01_00070901 predicted 447
5 SASI_Mm01_00070902 predicted 1016
6 SASI_Mm01_00070903 predicted 574
7 SASI_Mm01_00070904 predicted 394
8 SASI_Mm01_00070905 predicted 650
9 SASI_Mm01_00070906 predicted 685
10 SASI_Mm01_00070907 predicted 1095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013270
PRSS50 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 50
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013270.4-909s21c1
Sequence:CCGGCCCACTCTGGTTCAGATCATCCTCGAGGATGATCTGAACCAGAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013270.4-970s21c1
Sequence:CCGGAGTTCTGCTATGAGCTAACTGCTCGAGCAGTTAGCTCATAGCAGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013270.4-799s21c1
Sequence:CCGGTTTCCAAGGCTGACGGCATGTCTCGAGACATGCCGTCAGCCTTGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013270.4-342s21c1
Sequence:CCGGGAAGGCAAAGTCGACCCATACCTCGAGGTATGGGTCGACTTTGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-521s1c1
Sequence:CCGGGCGTGATGTTATCTACTCAGTCTCGAGACTGAGTAGATAACATCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-866s1c1
Sequence:CCGGGTGTGACAATTTCTACCACAACTCGAGTTGTGGTAGAAATTGTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-741s1c1
Sequence:CCGGGACTATGTGTTGAAGGACCATCTCGAGATGGTCCTTCAACACATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-689s1c1
Sequence:CCGGGCAGGAACTCAAGTACAGCAACTCGAGTTGCTGTACTTGAGTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-857s1c1
Sequence:CCGGCAACAAAGAGTGTGACAATTTCTCGAGAAATTGTCACACTCTTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013270
PRSS50 MISSION shRNA shRNA Plasmid DNA
protease, serine, 50
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013270.4-909s21c1
Sequence:CCGGCCCACTCTGGTTCAGATCATCCTCGAGGATGATCTGAACCAGAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013270.4-970s21c1
Sequence:CCGGAGTTCTGCTATGAGCTAACTGCTCGAGCAGTTAGCTCATAGCAGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013270.4-799s21c1
Sequence:CCGGTTTCCAAGGCTGACGGCATGTCTCGAGACATGCCGTCAGCCTTGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013270.4-342s21c1
Sequence:CCGGGAAGGCAAAGTCGACCCATACCTCGAGGTATGGGTCGACTTTGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-521s1c1
Sequence:CCGGGCGTGATGTTATCTACTCAGTCTCGAGACTGAGTAGATAACATCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-866s1c1
Sequence:CCGGGTGTGACAATTTCTACCACAACTCGAGTTGTGGTAGAAATTGTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-741s1c1
Sequence:CCGGGACTATGTGTTGAAGGACCATCTCGAGATGGTCCTTCAACACATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-689s1c1
Sequence:CCGGGCAGGAACTCAAGTACAGCAACTCGAGTTGCTGTACTTGAGTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-857s1c1
Sequence:CCGGCAACAAAGAGTGTGACAATTTCTCGAGAAATTGTCACACTCTTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013270
PRSS50 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 50
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013270.4-909s21c1
Sequence:CCGGCCCACTCTGGTTCAGATCATCCTCGAGGATGATCTGAACCAGAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013270.4-970s21c1
Sequence:CCGGAGTTCTGCTATGAGCTAACTGCTCGAGCAGTTAGCTCATAGCAGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013270.4-799s21c1
Sequence:CCGGTTTCCAAGGCTGACGGCATGTCTCGAGACATGCCGTCAGCCTTGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013270.4-342s21c1
Sequence:CCGGGAAGGCAAAGTCGACCCATACCTCGAGGTATGGGTCGACTTTGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-521s1c1
Sequence:CCGGGCGTGATGTTATCTACTCAGTCTCGAGACTGAGTAGATAACATCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-866s1c1
Sequence:CCGGGTGTGACAATTTCTACCACAACTCGAGTTGTGGTAGAAATTGTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-741s1c1
Sequence:CCGGGACTATGTGTTGAAGGACCATCTCGAGATGGTCCTTCAACACATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-689s1c1
Sequence:CCGGGCAGGAACTCAAGTACAGCAACTCGAGTTGCTGTACTTGAGTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013270.2-857s1c1
Sequence:CCGGCAACAAAGAGTGTGACAATTTCTCGAGAAATTGTCACACTCTTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146227
PRSS50 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 50
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-459s1c1
Sequence:CCGGCCGTTCTTAAGACGGTTCATTCTCGAGAATGAACCGTCTTAAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-732s1c1
Sequence:CCGGCGGTCCATCGAGTCATCATAACTCGAGTTATGATGACTCGATGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-1048s1c1
Sequence:CCGGTCGGATCATCAACCCTCAGATCTCGAGATCTGAGGGTTGATGATCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-1131s1c1
Sequence:CCGGTCTGCTCTTCAGATGGCACATCTCGAGATGTGCCATCTGAAGAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-994s1c1
Sequence:CCGGCAGCAAGAAATGTGATCATTTCTCGAGAAATGATCACATTTCTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146227
PRSS50 MISSION shRNA shRNA Plasmid DNA
protease, serine, 50
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-459s1c1
Sequence:CCGGCCGTTCTTAAGACGGTTCATTCTCGAGAATGAACCGTCTTAAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-732s1c1
Sequence:CCGGCGGTCCATCGAGTCATCATAACTCGAGTTATGATGACTCGATGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-1048s1c1
Sequence:CCGGTCGGATCATCAACCCTCAGATCTCGAGATCTGAGGGTTGATGATCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-1131s1c1
Sequence:CCGGTCTGCTCTTCAGATGGCACATCTCGAGATGTGCCATCTGAAGAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-994s1c1
Sequence:CCGGCAGCAAGAAATGTGATCATTTCTCGAGAAATGATCACATTTCTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146227
PRSS50 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 50
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-459s1c1
Sequence:CCGGCCGTTCTTAAGACGGTTCATTCTCGAGAATGAACCGTCTTAAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-732s1c1
Sequence:CCGGCGGTCCATCGAGTCATCATAACTCGAGTTATGATGACTCGATGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-1048s1c1
Sequence:CCGGTCGGATCATCAACCCTCAGATCTCGAGATCTGAGGGTTGATGATCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-1131s1c1
Sequence:CCGGTCTGCTCTTCAGATGGCACATCTCGAGATGTGCCATCTGAAGAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146227.2-994s1c1
Sequence:CCGGCAGCAAGAAATGTGATCATTTCTCGAGAAATGATCACATTTCTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)