EMAIL THIS PAGE TO A FRIEND

PRSS53

protease, serine, 53

73 Gene Product Result for
Synonyms: POL3S UNQ308
UniProtKB ID: Q2L4Q9
Gene ID:
Mouse(330657) protease, serine, 53
Rat(499270) protease, serine, 53
Horse(100064967) protease, serine, 53
domestic cat(101082870) protease, serine, 53
cow(511877) protease, serine, 53
sheep(101105973) protease, serine, 53
naked mole-rat(101709999) protease, serine, 53
Domestic Rabbit(100342246) protease, serine, 53
domestic guinea pig(100732887) protease, serine, 53
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_284356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039503 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU149801 MISSION® esiRNA esiRNA targeting mouse Prss53 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039503 Rosetta Predictions human pricing
NM_001109156 Rosetta Predictions rat pricing
NM_001081268 Rosetta Predictions mouse pricing
XM_620568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308547 predicted 1635
2 SASI_Hs02_00308548 predicted 1672
3 SASI_Hs02_00308549 predicted 1727
4 SASI_Hs01_00246145 predicted 517
5 SASI_Hs01_00246147 predicted 983
6 SASI_Hs01_00246148 predicted 703
7 SASI_Hs02_00308550 predicted 1561
8 SASI_Hs01_00246149 predicted 360
9 SASI_Hs01_00246150 predicted 478
10 SASI_Hs01_00246151 predicted 943
11 SASI_Hs01_00246144 predicted 880
12 SASI_Hs01_00246146 predicted 757
13 SASI_Hs01_00246152 predicted 346
14 SASI_Hs01_00246153 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245680 predicted 715
2 SASI_Rn02_00245681 predicted 873
3 SASI_Rn02_00245682 predicted 1031
4 SASI_Rn02_00245683 predicted 1710
5 SASI_Rn02_00245684 predicted 1579
6 SASI_Rn02_00245685 predicted 1482
7 SASI_Rn02_00245686 predicted 1101
8 SASI_Rn02_00245687 predicted 357
9 SASI_Rn02_00245688 predicted 1523
10 SASI_Rn02_00245689 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296807 predicted 1749
2 SASI_Mm02_00296808 predicted 931
3 SASI_Mm02_00296809 predicted 1692
4 SASI_Mm02_00296810 predicted 573
5 SASI_Mm02_00296811 predicted 1760
6 SASI_Mm02_00296812 predicted 768
7 SASI_Mm02_00296813 predicted 1003
8 SASI_Mm02_00296814 predicted 1586
9 SASI_Mm02_00296815 predicted 1517
10 SASI_Mm02_00296816 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256633 predicted 1753
2 SASI_Mm01_00256634 predicted 938
3 SASI_Mm01_00256635 predicted 1698
4 SASI_Mm01_00256636 predicted 582
5 SASI_Mm01_00256637 predicted 1761
6 SASI_Mm01_00256638 predicted 770
7 SASI_Mm01_00256639 predicted 1000
8 SASI_Mm01_00256640 predicted 1524
9 SASI_Mm01_00256641 predicted 917
10 SASI_Mm01_00256642 predicted 1142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284356
PRSS53 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 53
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-191s1c1
Sequence:CCGGGTCGTGATAGAGGGTCTTCAACTCGAGTTGAAGACCCTCTATCACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-495s1c1
Sequence:CCGGCCAAGGCCTATAACCACTATACTCGAGTATAGTGGTTATAGGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-1694s1c1
Sequence:CCGGGAGGACTGGATCAGCAATCTACTCGAGTAGATTGCTGATCCAGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-1642s1c1
Sequence:CCGGCACCTGTCAAAGCTCTGCAAACTCGAGTTTGCAGAGCTTTGACAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-859s1c1
Sequence:CCGGCCAGGTTGGAATCATTAGTTTCTCGAGAAACTAATGATTCCAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284356
PRSS53 MISSION shRNA shRNA Plasmid DNA
protease, serine, 53
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-191s1c1
Sequence:CCGGGTCGTGATAGAGGGTCTTCAACTCGAGTTGAAGACCCTCTATCACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-495s1c1
Sequence:CCGGCCAAGGCCTATAACCACTATACTCGAGTATAGTGGTTATAGGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-1694s1c1
Sequence:CCGGGAGGACTGGATCAGCAATCTACTCGAGTAGATTGCTGATCCAGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-1642s1c1
Sequence:CCGGCACCTGTCAAAGCTCTGCAAACTCGAGTTTGCAGAGCTTTGACAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-859s1c1
Sequence:CCGGCCAGGTTGGAATCATTAGTTTCTCGAGAAACTAATGATTCCAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284356
PRSS53 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 53
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-191s1c1
Sequence:CCGGGTCGTGATAGAGGGTCTTCAACTCGAGTTGAAGACCCTCTATCACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-495s1c1
Sequence:CCGGCCAAGGCCTATAACCACTATACTCGAGTATAGTGGTTATAGGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-1694s1c1
Sequence:CCGGGAGGACTGGATCAGCAATCTACTCGAGTAGATTGCTGATCCAGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-1642s1c1
Sequence:CCGGCACCTGTCAAAGCTCTGCAAACTCGAGTTTGCAGAGCTTTGACAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284356.2-859s1c1
Sequence:CCGGCCAGGTTGGAATCATTAGTTTCTCGAGAAACTAATGATTCCAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039503
PRSS53 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 53
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000256277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039503.2-1568s21c1
Sequence:CCGGGTTTGGACTGGCAGGTCTACTCTCGAGAGTAGACCTGCCAGTCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039503.2-342s21c1
Sequence:CCGGGCAGTTGCCCAGGGCCTATAACTCGAGTTATAGGCCCTGGGCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039503.2-45s21c1
Sequence:CCGGAGTCCTCATGGAGGGTCTTCACTCGAGTGAAGACCCTCCATGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039503.2-724s21c1
Sequence:CCGGATCATCAGCTTTGCATCAAGCCTCGAGGCTTGATGCAAAGCTGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039503
PRSS53 MISSION shRNA shRNA Plasmid DNA
protease, serine, 53
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000256277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039503.2-1568s21c1
Sequence:CCGGGTTTGGACTGGCAGGTCTACTCTCGAGAGTAGACCTGCCAGTCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039503.2-342s21c1
Sequence:CCGGGCAGTTGCCCAGGGCCTATAACTCGAGTTATAGGCCCTGGGCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039503.2-45s21c1
Sequence:CCGGAGTCCTCATGGAGGGTCTTCACTCGAGTGAAGACCCTCCATGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039503.2-724s21c1
Sequence:CCGGATCATCAGCTTTGCATCAAGCCTCGAGGCTTGATGCAAAGCTGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039503
PRSS53 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 53
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000256277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039503.2-1568s21c1
Sequence:CCGGGTTTGGACTGGCAGGTCTACTCTCGAGAGTAGACCTGCCAGTCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039503.2-342s21c1
Sequence:CCGGGCAGTTGCCCAGGGCCTATAACTCGAGTTATAGGCCCTGGGCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039503.2-45s21c1
Sequence:CCGGAGTCCTCATGGAGGGTCTTCACTCGAGTGAAGACCCTCCATGAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039503.2-724s21c1
Sequence:CCGGATCATCAGCTTTGCATCAAGCCTCGAGGCTTGATGCAAAGCTGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)