EMAIL THIS PAGE TO A FRIEND

PRSS57

protease, serine, 57

48 Gene Product Result for
Synonyms: PRSSL1 UNQ782
UniProtKB ID: Q6UWY2, B2RNW8
Gene ID:
Mouse(73106) protease, serine 57
Rat(408241) protease, serine, 57
dog(485099) protease, serine, 57
domestic cat(101092003) protease, serine, 57
cow(515368) protease, serine, 57
sheep(101109538) protease, serine, 57
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_196763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_196763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_196763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_375552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375552 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026311 MISSION® esiRNA esiRNA human PRSSL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_214710 Rosetta Predictions human pricing
NM_001003956 Rosetta Predictions rat pricing
NM_001042710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_214710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205795 predicted 782
2 SASI_Hs02_00374392 predicted 341
3 SASI_Hs01_00205796 predicted 599
4 SASI_Hs01_00205797 predicted 516
5 SASI_Hs01_00205798 predicted 407
6 SASI_Hs01_00205799 predicted 330
7 SASI_Hs02_00374393 predicted 620
8 SASI_Hs01_00205800 predicted 303
9 SASI_Hs01_00205802 predicted 875
10 SASI_Hs01_00205804 predicted 1021
11 SASI_Hs01_00205801 predicted 367
12 SASI_Hs01_00205803 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059129 predicted 457
2 SASI_Rn01_00059131 predicted 365
3 SASI_Rn01_00059132 predicted 294
4 SASI_Rn02_00198070 predicted 284
5 SASI_Rn01_00059133 predicted 404
6 SASI_Rn01_00059135 predicted 416
7 SASI_Rn01_00059136 predicted 338
8 SASI_Rn01_00059137 predicted 285
9 SASI_Rn01_00059138 predicted 286
10 SASI_Rn02_00198071 predicted 281
11 SASI_Rn01_00059130 predicted 217
12 SASI_Rn01_00059134 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290995 predicted 1257
2 SASI_Mm02_00290996 predicted 1039
3 SASI_Mm02_00290997 predicted 1254
4 SASI_Mm02_00290998 predicted 1172
5 SASI_Mm02_00290999 predicted 433
6 SASI_Mm02_00291000 predicted 1020
7 SASI_Mm02_00291001 predicted 1331
8 SASI_Mm02_00291002 predicted 1034
9 SASI_Mm02_00291003 predicted 792
10 SASI_Mm02_00291004 predicted 1222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_196763
PRSS57 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 57
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_196763.3-1052s1c1
Sequence:CCGGGCATTCATCCTAAATGAACAACTCGAGTTGTTCATTTAGGATGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196763.3-729s1c1
Sequence:CCGGACTGGATCTGAGTGTCTGCAACTCGAGTTGCAGACACTCAGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196763.3-365s1c1
Sequence:CCGGGCTTCCTGATTCATACCCATTCTCGAGAATGGGTATGAATCAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196763.3-293s1c1
Sequence:CCGGGCCATGAGGTAACGCCACATTCTCGAGAATGTGGCGTTACCTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196763.3-277s1c1
Sequence:CCGGTCCTACATTGTTGGAGGCCATCTCGAGATGGCCTCCAACAATGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_196763
PRSS57 MISSION shRNA shRNA Plasmid DNA
protease, serine, 57
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_196763.3-1052s1c1
Sequence:CCGGGCATTCATCCTAAATGAACAACTCGAGTTGTTCATTTAGGATGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196763.3-729s1c1
Sequence:CCGGACTGGATCTGAGTGTCTGCAACTCGAGTTGCAGACACTCAGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196763.3-365s1c1
Sequence:CCGGGCTTCCTGATTCATACCCATTCTCGAGAATGGGTATGAATCAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196763.3-293s1c1
Sequence:CCGGGCCATGAGGTAACGCCACATTCTCGAGAATGTGGCGTTACCTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196763.3-277s1c1
Sequence:CCGGTCCTACATTGTTGGAGGCCATCTCGAGATGGCCTCCAACAATGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_196763
PRSS57 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 57
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_196763.3-1052s1c1
Sequence:CCGGGCATTCATCCTAAATGAACAACTCGAGTTGTTCATTTAGGATGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196763.3-729s1c1
Sequence:CCGGACTGGATCTGAGTGTCTGCAACTCGAGTTGCAGACACTCAGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196763.3-365s1c1
Sequence:CCGGGCTTCCTGATTCATACCCATTCTCGAGAATGGGTATGAATCAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196763.3-293s1c1
Sequence:CCGGGCCATGAGGTAACGCCACATTCTCGAGAATGTGGCGTTACCTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196763.3-277s1c1
Sequence:CCGGTCCTACATTGTTGGAGGCCATCTCGAGATGGCCTCCAACAATGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375552
PRSS57 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 57
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000118578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375552.1-232s1c1
Sequence:CCGGCCAACATCACTGCGGAGGCTTCTCGAGAAGCCTCCGCAGTGATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375552.1-583s1c1
Sequence:CCGGGCCTGGACTGATGGAGGCCAACTCGAGTTGGCCTCCATCAGTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375552.1-118s1c1
Sequence:CCGGCGCCCTGATGCTGCCCGTGAACTCGAGTTCACGGGCAGCATCAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375552.1-833s1c1
Sequence:CCGGGCCTGGATCTGGGACGTGGTTCTCGAGAACCACGTCCCAGATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375552
PRSS57 MISSION shRNA shRNA Plasmid DNA
protease, serine, 57
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000118578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375552.1-232s1c1
Sequence:CCGGCCAACATCACTGCGGAGGCTTCTCGAGAAGCCTCCGCAGTGATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375552.1-583s1c1
Sequence:CCGGGCCTGGACTGATGGAGGCCAACTCGAGTTGGCCTCCATCAGTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375552.1-118s1c1
Sequence:CCGGCGCCCTGATGCTGCCCGTGAACTCGAGTTCACGGGCAGCATCAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375552.1-833s1c1
Sequence:CCGGGCCTGGATCTGGGACGTGGTTCTCGAGAACCACGTCCCAGATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375552
PRSS57 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 57
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000118578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375552.1-232s1c1
Sequence:CCGGCCAACATCACTGCGGAGGCTTCTCGAGAAGCCTCCGCAGTGATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375552.1-583s1c1
Sequence:CCGGGCCTGGACTGATGGAGGCCAACTCGAGTTGGCCTCCATCAGTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375552.1-118s1c1
Sequence:CCGGCGCCCTGATGCTGCCCGTGAACTCGAGTTCACGGGCAGCATCAGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375552.1-833s1c1
Sequence:CCGGGCCTGGATCTGGGACGTGGTTCTCGAGAACCACGTCCCAGATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)