EMAIL THIS PAGE TO A FRIEND

PRSS58

protease, serine, 58

48 Gene Product Result for
Synonyms: PRSS1 TRY1 TRYX3 UNQ2540
UniProtKB ID: Q8IYP2, B3KVJ6, D3DXD2
Gene ID:
Human(136541) Summary: This gene encodes a member of the trypsin family of serine proteases. This gene and several related trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. This gene was previously described as a trypsinogen-like pseudogene, but it is now thought to be a protein-coding gene. [provided by RefSeq, Jul 2008]
Mouse(232717) protease, serine 58
Rat(408204) protease, serine, 58
cow(506919) protease, serine, 58
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107700 Anti-PRSS58 antibody produced in rabbit affinity isolated antibody horse, rabbit, human
ELISA, western blot pricing
SAB2107701 Anti-PRSS58 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, human, horse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001317 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024591 MISSION® esiRNA esiRNA human U66059.1-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001317 Rosetta Predictions human pricing
NM_001009174 Rosetta Predictions rat pricing
NM_175020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184252 predicted 469
2 SASI_Hs02_00303712 predicted 506
3 SASI_Hs01_00184253 predicted 552
4 SASI_Hs01_00184255 predicted 256
5 SASI_Hs01_00184256 predicted 595
6 SASI_Hs01_00184257 predicted 355
7 SASI_Hs02_00303713 predicted 342
8 SASI_Hs01_00184258 predicted 443
9 SASI_Hs01_00184259 predicted 305
10 SASI_Hs01_00184260 predicted 388
11 SASI_Hs01_00184251 predicted 514
12 SASI_Hs01_00184254 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009174 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074757 predicted 317
2 SASI_Rn01_00074759 predicted 323
3 SASI_Rn01_00074760 predicted 295
4 SASI_Rn01_00074761 predicted 350
5 SASI_Rn01_00074762 predicted 395
6 SASI_Rn01_00074763 predicted 400
7 SASI_Rn01_00074764 predicted 304
8 SASI_Rn01_00074765 predicted 490
9 SASI_Rn02_00199492 predicted 262
10 SASI_Rn02_00199493 predicted 435
11 SASI_Rn01_00074758 predicted 481
12 SASI_Rn01_00074766 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172349 predicted 603
2 SASI_Mm01_00172352 predicted 486
3 SASI_Mm01_00172350 predicted 554
4 SASI_Mm02_00345592 predicted 644
5 SASI_Mm01_00172351 predicted 369
6 SASI_Mm01_00172353 predicted 208
7 SASI_Mm01_00172355 predicted 382
8 SASI_Mm01_00172354 predicted 455
9 SASI_Mm01_00172357 predicted 631
10 SASI_Mm01_00172358 predicted 279
11 SASI_Mm01_00172356 predicted 463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001317
PRSS58 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 58
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-469s1c1
Sequence:CCGGCCTACCAAACTATCTCTGAAACTCGAGTTTCAGAGATAGTTTGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-696s1c1
Sequence:CCGGGCAATCTGCAATGGGATGCTTCTCGAGAAGCATCCCATTGCAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-186s1c1
Sequence:CCGGCCTTACTTGGTCTATTTGAAACTCGAGTTTCAAATAGACCAAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-435s1c1
Sequence:CCGGGAACTCAATGACTATGTGAAACTCGAGTTTCACATAGTCATTGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-128s1c1
Sequence:CCGGCTTGAATCTGACTGTTGCTTTCTCGAGAAAGCAACAGTCAGATTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001317.2-285s21c1
Sequence:CCGGTACCAAAGCTTCGGGTGATATCTCGAGATATCACCCGAAGCTTTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001317.2-599s21c1
Sequence:CCGGCAGTGTCGCGATGCCTATAAACTCGAGTTTATAGGCATCGCGACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001317.2-403s21c1
Sequence:CCGGTGATCATGACATCATGCTAATCTCGAGATTAGCATGATGTCATGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001317
PRSS58 MISSION shRNA shRNA Plasmid DNA
protease, serine, 58
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-469s1c1
Sequence:CCGGCCTACCAAACTATCTCTGAAACTCGAGTTTCAGAGATAGTTTGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-696s1c1
Sequence:CCGGGCAATCTGCAATGGGATGCTTCTCGAGAAGCATCCCATTGCAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-186s1c1
Sequence:CCGGCCTTACTTGGTCTATTTGAAACTCGAGTTTCAAATAGACCAAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-435s1c1
Sequence:CCGGGAACTCAATGACTATGTGAAACTCGAGTTTCACATAGTCATTGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-128s1c1
Sequence:CCGGCTTGAATCTGACTGTTGCTTTCTCGAGAAAGCAACAGTCAGATTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001317.2-285s21c1
Sequence:CCGGTACCAAAGCTTCGGGTGATATCTCGAGATATCACCCGAAGCTTTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001317.2-599s21c1
Sequence:CCGGCAGTGTCGCGATGCCTATAAACTCGAGTTTATAGGCATCGCGACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001317.2-403s21c1
Sequence:CCGGTGATCATGACATCATGCTAATCTCGAGATTAGCATGATGTCATGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001317
PRSS58 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 58
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-469s1c1
Sequence:CCGGCCTACCAAACTATCTCTGAAACTCGAGTTTCAGAGATAGTTTGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-696s1c1
Sequence:CCGGGCAATCTGCAATGGGATGCTTCTCGAGAAGCATCCCATTGCAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-186s1c1
Sequence:CCGGCCTTACTTGGTCTATTTGAAACTCGAGTTTCAAATAGACCAAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-435s1c1
Sequence:CCGGGAACTCAATGACTATGTGAAACTCGAGTTTCACATAGTCATTGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001317.1-128s1c1
Sequence:CCGGCTTGAATCTGACTGTTGCTTTCTCGAGAAAGCAACAGTCAGATTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001317.2-285s21c1
Sequence:CCGGTACCAAAGCTTCGGGTGATATCTCGAGATATCACCCGAAGCTTTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001317.2-599s21c1
Sequence:CCGGCAGTGTCGCGATGCCTATAAACTCGAGTTTATAGGCATCGCGACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001317.2-403s21c1
Sequence:CCGGTGATCATGACATCATGCTAATCTCGAGATTAGCATGATGTCATGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175020
PRSS58 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 58
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-340s1c1
Sequence:CCGGCCGAACCTTCAAGTGATTCTTCTCGAGAAGAATCACTTGAAGGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-346s1c1
Sequence:CCGGCTTCAAGTGATTCTTGGGATACTCGAGTATCCCAAGAATCACTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-486s1c1
Sequence:CCGGGAGACGGATTAAACATAGTAACTCGAGTTACTATGTTTAATCCGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-658s1c1
Sequence:CCGGCGTAATGCCTATAAAGCCTTTCTCGAGAAAGGCTTTATAGGCATTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-485s1c1
Sequence:CCGGAGAGACGGATTAAACATAGTACTCGAGTACTATGTTTAATCCGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175020
PRSS58 MISSION shRNA shRNA Plasmid DNA
protease, serine, 58
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-340s1c1
Sequence:CCGGCCGAACCTTCAAGTGATTCTTCTCGAGAAGAATCACTTGAAGGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-346s1c1
Sequence:CCGGCTTCAAGTGATTCTTGGGATACTCGAGTATCCCAAGAATCACTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-486s1c1
Sequence:CCGGGAGACGGATTAAACATAGTAACTCGAGTTACTATGTTTAATCCGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-658s1c1
Sequence:CCGGCGTAATGCCTATAAAGCCTTTCTCGAGAAAGGCTTTATAGGCATTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-485s1c1
Sequence:CCGGAGAGACGGATTAAACATAGTACTCGAGTACTATGTTTAATCCGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175020
PRSS58 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 58
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-340s1c1
Sequence:CCGGCCGAACCTTCAAGTGATTCTTCTCGAGAAGAATCACTTGAAGGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-346s1c1
Sequence:CCGGCTTCAAGTGATTCTTGGGATACTCGAGTATCCCAAGAATCACTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-486s1c1
Sequence:CCGGGAGACGGATTAAACATAGTAACTCGAGTTACTATGTTTAATCCGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-658s1c1
Sequence:CCGGCGTAATGCCTATAAAGCCTTTCTCGAGAAAGGCTTTATAGGCATTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175020.1-485s1c1
Sequence:CCGGAGAGACGGATTAAACATAGTACTCGAGTACTATGTTTAATCCGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)