EMAIL THIS PAGE TO A FRIEND

PRSS8

protease, serine, 8

64 Gene Product Result for
Synonyms: CAP1 PROSTASIN
UniProtKB ID: Q16651, Q9UCA3
Gene ID:
Human(5652) Summary: This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is highly expressed in prostate epithelia and is one of several proteolytic enzymes found in seminal fluid. The proprotein is cleaved to produce a light chain and a heavy chain which are associated by a disulfide bond. It is active on peptide linkages involving the carboxyl group of lysine or arginine. [provided by RefSeq, Jul 2008]
Mouse(76560) protease, serine, 8 (prostasin)
Rat(192107) protease, serine, 8
dog(607168) protease, serine, 8
domestic cat(101082616) protease, serine, 8
cow(613506) protease, serine, 8
domestic guinea pig(100733172) protease, serine, 8
naked mole-rat(101713522) protease, serine, 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002773 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005521 MISSION® esiRNA esiRNA targeting human PRSS8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002773 Rosetta Predictions human pricing
NM_138836 Rosetta Predictions rat pricing
NM_133351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145793 predicted 756
2 SASI_Hs01_00145794 predicted 530
3 SASI_Hs01_00145795 predicted 965
4 SASI_Hs01_00145796 predicted 749
5 SASI_Hs01_00145797 predicted 1450
6 SASI_Hs01_00145798 predicted 1064
7 SASI_Hs01_00145799 predicted 514
8 SASI_Hs01_00145800 predicted 909
9 SASI_Hs01_00145801 predicted 1120
10 SASI_Hs02_00334401 predicted 1496
11 SASI_Hs01_00145802 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099467 predicted 950
2 SASI_Rn01_00099469 predicted 409
3 SASI_Rn01_00099470 predicted 1249
4 SASI_Rn01_00099471 predicted 858
5 SASI_Rn02_00268214 predicted 1246
6 SASI_Rn01_00099472 predicted 739
7 SASI_Rn02_00268215 predicted 408
8 SASI_Rn01_00099473 predicted 1231
9 SASI_Rn01_00099474 predicted 716
10 SASI_Rn01_00099475 predicted 1296
11 SASI_Rn01_00099468 predicted 548
12 SASI_Rn01_00099476 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175179 predicted 1206
2 SASI_Mm02_00338530 predicted 1089
3 SASI_Mm01_00175180 predicted 1321
4 SASI_Mm01_00175181 predicted 1099
5 SASI_Mm01_00175183 predicted 715
6 SASI_Mm02_00338531 predicted 1245
7 SASI_Mm01_00175184 predicted 1364
8 SASI_Mm01_00175185 predicted 402
9 SASI_Mm01_00175186 predicted 261
10 SASI_Mm01_00175187 predicted 1289
11 SASI_Mm01_00175182 predicted 1379
12 SASI_Mm01_00175188 predicted 862
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002773
PRSS8 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002773.3-762s21c1
Sequence:CCGGATCACCTTCTCCCGCTACATCCTCGAGGATGTAGCGGGAGAAGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-375s1c1
Sequence:CCGGGTGGCCATTCTGCTCTATCTTCTCGAGAAGATAGAGCAGAATGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-600s1c1
Sequence:CCGGGAGCACCACAAGGAAGCCTATCTCGAGATAGGCTTCCTTGTGGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-974s1c1
Sequence:CCGGGCACTTTGTCCAAGAGGACATCTCGAGATGTCCTCTTGGACAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-516s1c1
Sequence:CCGGATCACCTATGAAGGCGTCCATCTCGAGATGGACGCCTTCATAGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-929s1c1
Sequence:CCGGGACGTGTAACTGCCTGTACAACTCGAGTTGTACAGGCAGTTACACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002773.3-1642s21c1
Sequence:CCGGCTGGGACCCTTGGCTATGAAACTCGAGTTTCATAGCCAAGGGTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002773.3-1499s21c1
Sequence:CCGGTTGATCTTTGAGCCCATTCTTCTCGAGAAGAATGGGCTCAAAGATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002773
PRSS8 MISSION shRNA shRNA Plasmid DNA
protease, serine, 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002773.3-762s21c1
Sequence:CCGGATCACCTTCTCCCGCTACATCCTCGAGGATGTAGCGGGAGAAGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-375s1c1
Sequence:CCGGGTGGCCATTCTGCTCTATCTTCTCGAGAAGATAGAGCAGAATGGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-600s1c1
Sequence:CCGGGAGCACCACAAGGAAGCCTATCTCGAGATAGGCTTCCTTGTGGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-974s1c1
Sequence:CCGGGCACTTTGTCCAAGAGGACATCTCGAGATGTCCTCTTGGACAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-516s1c1
Sequence:CCGGATCACCTATGAAGGCGTCCATCTCGAGATGGACGCCTTCATAGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-929s1c1
Sequence:CCGGGACGTGTAACTGCCTGTACAACTCGAGTTGTACAGGCAGTTACACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002773.3-1642s21c1
Sequence:CCGGCTGGGACCCTTGGCTATGAAACTCGAGTTTCATAGCCAAGGGTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002773.3-1499s21c1
Sequence:CCGGTTGATCTTTGAGCCCATTCTTCTCGAGAAGAATGGGCTCAAAGATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002773
PRSS8 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002773.3-762s21c1
Sequence:CCGGATCACCTTCTCCCGCTACATCCTCGAGGATGTAGCGGGAGAAGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-375s1c1
Sequence:CCGGGTGGCCATTCTGCTCTATCTTCTCGAGAAGATAGAGCAGAATGGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-600s1c1
Sequence:CCGGGAGCACCACAAGGAAGCCTATCTCGAGATAGGCTTCCTTGTGGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-974s1c1
Sequence:CCGGGCACTTTGTCCAAGAGGACATCTCGAGATGTCCTCTTGGACAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-516s1c1
Sequence:CCGGATCACCTATGAAGGCGTCCATCTCGAGATGGACGCCTTCATAGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002773.2-929s1c1
Sequence:CCGGGACGTGTAACTGCCTGTACAACTCGAGTTGTACAGGCAGTTACACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002773.3-1642s21c1
Sequence:CCGGCTGGGACCCTTGGCTATGAAACTCGAGTTTCATAGCCAAGGGTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002773.3-1499s21c1
Sequence:CCGGTTGATCTTTGAGCCCATTCTTCTCGAGAAGAATGGGCTCAAAGATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133351
PRSS8 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-431s1c1
Sequence:CCGGGCTCGTGTCAAATAAATGGGTCTCGAGACCCATTTATTTGACACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-1015s1c1
Sequence:CCGGCTGGAGTATACACTCTGACTTCTCGAGAAGTCAGAGTGTATACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-522s1c1
Sequence:CCGGCAGCTAGACTCCTACAGCAATCTCGAGATTGCTGTAGGAGTCTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-842s1c1
Sequence:CCGGGCCTGAAGAACCGCACACTATCTCGAGATAGTGTGCGGTTCTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-1164s1c1
Sequence:CCGGCCGAAATTGTTAAGGCCCGTACTCGAGTACGGGCCTTAACAATTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133351
PRSS8 MISSION shRNA shRNA Plasmid DNA
protease, serine, 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-431s1c1
Sequence:CCGGGCTCGTGTCAAATAAATGGGTCTCGAGACCCATTTATTTGACACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-1015s1c1
Sequence:CCGGCTGGAGTATACACTCTGACTTCTCGAGAAGTCAGAGTGTATACTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-522s1c1
Sequence:CCGGCAGCTAGACTCCTACAGCAATCTCGAGATTGCTGTAGGAGTCTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-842s1c1
Sequence:CCGGGCCTGAAGAACCGCACACTATCTCGAGATAGTGTGCGGTTCTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-1164s1c1
Sequence:CCGGCCGAAATTGTTAAGGCCCGTACTCGAGTACGGGCCTTAACAATTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133351
PRSS8 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-431s1c1
Sequence:CCGGGCTCGTGTCAAATAAATGGGTCTCGAGACCCATTTATTTGACACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-1015s1c1
Sequence:CCGGCTGGAGTATACACTCTGACTTCTCGAGAAGTCAGAGTGTATACTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-522s1c1
Sequence:CCGGCAGCTAGACTCCTACAGCAATCTCGAGATTGCTGTAGGAGTCTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-842s1c1
Sequence:CCGGGCCTGAAGAACCGCACACTATCTCGAGATAGTGTGCGGTTCTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133351.1-1164s1c1
Sequence:CCGGCCGAAATTGTTAAGGCCCGTACTCGAGTACGGGCCTTAACAATTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)