EMAIL THIS PAGE TO A FRIEND

PRTFDC1

phosphoribosyl transferase domain containing 1

111 Gene Product Result for
Synonyms: HHGP
UniProtKB ID: Q9NRG1, B7Z1Z3, Q53HA7, Q59EL9, Q5VV18, Q5VV20
Gene ID:
Rat(291355) phosphoribosyl transferase domain containing 1
Zebrafish(30765) phosphoribosyl transferase domain containing 1
chicken(420499) phosphoribosyl transferase domain containing 1
dog(487103) phosphoribosyl transferase domain containing 1
domestic cat(101086486) phosphoribosyl transferase domain containing 1
cow(788520) phosphoribosyl transferase domain containing 1
sheep(101105429) phosphoribosyl transferase domain containing 1
naked mole-rat(101702604) phosphoribosyl transferase domain containing 1
Domestic Rabbit(100008667) phosphoribosyl transferase domain containing 1
domestic guinea pig(100712883) phosphoribosyl transferase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020200 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061881 MISSION® esiRNA esiRNA human PRTFDC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020200 Rosetta Predictions human pricing
NM_001106127 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019452 predicted 702
2 SASI_Hs01_00019453 predicted 333
3 SASI_Hs01_00019454 predicted 250
4 SASI_Hs01_00019455 predicted 612
5 SASI_Hs01_00019456 predicted 691
6 SASI_Hs01_00019458 predicted 664
7 SASI_Hs01_00019459 predicted 573
8 SASI_Hs01_00019460 predicted 211
9 SASI_Hs01_00019461 predicted 310
10 SASI_Hs02_00353137 predicted 326
11 SASI_Hs01_00019457 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215888 predicted 264
2 SASI_Rn02_00215889 predicted 434
3 SASI_Rn02_00215890 predicted 624
4 SASI_Rn02_00215891 predicted 578
5 SASI_Rn02_00215892 predicted 668
6 SASI_Rn02_00215893 predicted 798
7 SASI_Rn02_00215894 predicted 268
8 SASI_Rn02_00215895 predicted 427
9 SASI_Rn02_00215896 predicted 640
10 SASI_Rn02_00215897 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020200
VALIDATED
PRTFDC1 MISSION shRNA Bacterial Glycerol Stock
phosphoribosyl transferase domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020200.5-70s1c1
Sequence:CCGGGCGTCGTGATTATGGATGATTCTCGAGAATCATCCATAATCACGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020200.5-218s1c1
Sequence:CCGGCATAGGATATAGTGACATCATCTCGAGATGATGTCACTATATCCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020200.5-668s1c1
Sequence:CCGGCGTCATCAATGAGCACGGTAACTCGAGTTACCGTGCTCATTGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020200.5-426s1c1
Sequence:CCGGGCTGGAAAGAATGTTCTCATTCTCGAGAATGAGAACATTCTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020200.5-553s21c1
Sequence:CCCGCATCCAGAAGTGACGGCTTTACTCGAGTAAAGCCGTCACTTCTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020200.5-338s21c1
Sequence:CCGGGGTTGATTTCATCAGACTAAACTCGAGTTTAGTCTGATGAAATCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020200.5-1155s21c1
Sequence:CCGGACCGGGAATGCAGCTATTAATCTCGAGATTAATAGCTGCATTCCCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020200.5-278s21c1
Sequence:CCGGTGATCTCGTAGAACACCTTAACTCGAGTTAAGGTGTTCTACGAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020200.5-250s21c1
Sequence:CCGGTGCTTAAAGGAGGTTACAAATCTCGAGATTTGTAACCTCCTTTAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020200
VALIDATED
PRTFDC1 MISSION shRNA shRNA Plasmid DNA
phosphoribosyl transferase domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020200.5-70s1c1
Sequence:CCGGGCGTCGTGATTATGGATGATTCTCGAGAATCATCCATAATCACGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020200.5-218s1c1
Sequence:CCGGCATAGGATATAGTGACATCATCTCGAGATGATGTCACTATATCCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020200.5-668s1c1
Sequence:CCGGCGTCATCAATGAGCACGGTAACTCGAGTTACCGTGCTCATTGATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020200.5-426s1c1
Sequence:CCGGGCTGGAAAGAATGTTCTCATTCTCGAGAATGAGAACATTCTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020200.5-553s21c1
Sequence:CCCGCATCCAGAAGTGACGGCTTTACTCGAGTAAAGCCGTCACTTCTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020200.5-338s21c1
Sequence:CCGGGGTTGATTTCATCAGACTAAACTCGAGTTTAGTCTGATGAAATCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020200.5-1155s21c1
Sequence:CCGGACCGGGAATGCAGCTATTAATCTCGAGATTAATAGCTGCATTCCCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020200.5-278s21c1
Sequence:CCGGTGATCTCGTAGAACACCTTAACTCGAGTTAAGGTGTTCTACGAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020200.5-250s21c1
Sequence:CCGGTGCTTAAAGGAGGTTACAAATCTCGAGATTTGTAACCTCCTTTAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020200
VALIDATED
PRTFDC1 MISSION shRNA Lentiviral Transduction Particles
phosphoribosyl transferase domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020200.5-70s1c1
Sequence:CCGGGCGTCGTGATTATGGATGATTCTCGAGAATCATCCATAATCACGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020200.5-218s1c1
Sequence:CCGGCATAGGATATAGTGACATCATCTCGAGATGATGTCACTATATCCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020200.5-668s1c1
Sequence:CCGGCGTCATCAATGAGCACGGTAACTCGAGTTACCGTGCTCATTGATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020200.5-426s1c1
Sequence:CCGGGCTGGAAAGAATGTTCTCATTCTCGAGAATGAGAACATTCTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020200.5-553s21c1
Sequence:CCCGCATCCAGAAGTGACGGCTTTACTCGAGTAAAGCCGTCACTTCTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020200.5-338s21c1
Sequence:CCGGGGTTGATTTCATCAGACTAAACTCGAGTTTAGTCTGATGAAATCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020200.5-1155s21c1
Sequence:CCGGACCGGGAATGCAGCTATTAATCTCGAGATTAATAGCTGCATTCCCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020200.5-278s21c1
Sequence:CCGGTGATCTCGTAGAACACCTTAACTCGAGTTAAGGTGTTCTACGAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020200.5-250s21c1
Sequence:CCGGTGCTTAAAGGAGGTTACAAATCTCGAGATTTGTAACCTCCTTTAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)