EMAIL THIS PAGE TO A FRIEND

PRTN3

proteinase 3

55 Gene Product Result for
Synonyms: ACPA AGP7 C-ANCA CANCA MBN MBT NP-4 NP4 P29 PR-3 PR3
Gene ID:
Mouse(19152) proteinase 3
Rat(314615) proteinase 3
cow(100298591) proteinase 3
sheep(101110590) proteinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002777 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002777 Rosetta Predictions human pricing
NM_001024264 Rosetta Predictions rat pricing
NM_011178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176150 predicted 666
2 SASI_Hs02_00334410 predicted 343
3 SASI_Hs01_00176152 predicted 411
4 SASI_Hs01_00176153 predicted 275
5 SASI_Hs01_00176154 predicted 610
6 SASI_Hs01_00176155 predicted 663
7 SASI_Hs01_00176156 predicted 347
8 SASI_Hs01_00176157 predicted 725
9 SASI_Hs01_00176158 predicted 647
10 SASI_Hs01_00176159 predicted 612
11 SASI_Hs01_00176151 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097649 predicted 291
2 SASI_Rn01_00097650 predicted 376
3 SASI_Rn01_00097651 predicted 222
4 SASI_Rn01_00097653 predicted 450
5 SASI_Rn01_00097654 predicted 346
6 SASI_Rn01_00097655 predicted 310
7 SASI_Rn01_00097656 predicted 280
8 SASI_Rn01_00097657 predicted 373
9 SASI_Rn01_00097658 predicted 337
10 SASI_Rn02_00202440 predicted 341
11 SASI_Rn01_00097652 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154030 predicted 301
2 SASI_Mm01_00154031 predicted 367
3 SASI_Mm01_00154032 predicted 598
4 SASI_Mm01_00154033 predicted 324
5 SASI_Mm01_00154034 predicted 690
6 SASI_Mm01_00154035 predicted 351
7 SASI_Mm01_00154036 predicted 698
8 SASI_Mm01_00154037 predicted 543
9 SASI_Mm01_00154038 predicted 554
10 SASI_Mm01_00154039 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002777
PRTN3 MISSION shRNA Bacterial Glycerol Stock
proteinase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-597s1c1
Sequence:CCGGGCCACATAACATTTGCACTTTCTCGAGAAAGTGCAAATGTTATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-385s1c1
Sequence:CCGGGAGAACAAACTGAACGACATTCTCGAGAATGTCGTTCAGTTTGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-736s1c1
Sequence:CCGGCCTGACTTCTTCACGCGGGTACTCGAGTACCCGCGTGAAGAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-666s1c1
Sequence:CCGGCCTGATCTGTGATGGCATCATCTCGAGATGATGCCATCACAGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-676s1c1
Sequence:CCGGGATGGCATCATCCAAGGAATACTCGAGTATTCCTTGGATGATGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002777.3-539s21c1
Sequence:CCGGAGCTCAATGTCACCGTGGTCACTCGAGTGACCACGGTGACATTGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002777.3-614s21c1
Sequence:CCGGGCATCTGCTTCGGAGACTCAGCTCGAGCTGAGTCTCCGAAGCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002777
PRTN3 MISSION shRNA shRNA Plasmid DNA
proteinase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-597s1c1
Sequence:CCGGGCCACATAACATTTGCACTTTCTCGAGAAAGTGCAAATGTTATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-385s1c1
Sequence:CCGGGAGAACAAACTGAACGACATTCTCGAGAATGTCGTTCAGTTTGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-736s1c1
Sequence:CCGGCCTGACTTCTTCACGCGGGTACTCGAGTACCCGCGTGAAGAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-666s1c1
Sequence:CCGGCCTGATCTGTGATGGCATCATCTCGAGATGATGCCATCACAGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-676s1c1
Sequence:CCGGGATGGCATCATCCAAGGAATACTCGAGTATTCCTTGGATGATGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000455018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002777.3-539s21c1
Sequence:CCGGAGCTCAATGTCACCGTGGTCACTCGAGTGACCACGGTGACATTGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002777.3-614s21c1
Sequence:CCGGGCATCTGCTTCGGAGACTCAGCTCGAGCTGAGTCTCCGAAGCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002777
PRTN3 MISSION shRNA Lentiviral Transduction Particles
proteinase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-597s1c1
Sequence:CCGGGCCACATAACATTTGCACTTTCTCGAGAAAGTGCAAATGTTATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-385s1c1
Sequence:CCGGGAGAACAAACTGAACGACATTCTCGAGAATGTCGTTCAGTTTGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-736s1c1
Sequence:CCGGCCTGACTTCTTCACGCGGGTACTCGAGTACCCGCGTGAAGAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-666s1c1
Sequence:CCGGCCTGATCTGTGATGGCATCATCTCGAGATGATGCCATCACAGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002777.2-676s1c1
Sequence:CCGGGATGGCATCATCCAAGGAATACTCGAGTATTCCTTGGATGATGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002777.3-539s21c1
Sequence:CCGGAGCTCAATGTCACCGTGGTCACTCGAGTGACCACGGTGACATTGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002777.3-614s21c1
Sequence:CCGGGCATCTGCTTCGGAGACTCAGCTCGAGCTGAGTCTCCGAAGCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011178
PRTN3 MISSION shRNA Bacterial Glycerol Stock
proteinase 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011178.2-815s1c1
Sequence:CCGGCCAGCAGGCTCTAGTGGGAAACTCGAGTTTCCCACTAGAGCCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011178.2-631s1c1
Sequence:CCGGCCCTTGATCTGCAATGGCATTCTCGAGAATGCCATTGCAGATCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011178.2-647s1c1
Sequence:CCGGGCATTCTTCATGGAGTGGACTCTCGAGAGTCCACTCCATGAAGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011178.2-323s1c1
Sequence:CCGGGTCAGGTCTTCCAGAACAATTCTCGAGAATTGTTCTGGAAGACCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011178.2-355s1c1
Sequence:CCGGGAGAACCTCAATGACGTGCTTCTCGAGAAGCACGTCATTGAGGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011178.2-190s21c1
Sequence:CCGGACCCTGATCCACCCGAGATTCCTCGAGGAATCTCGGGTGGATCAGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011178.2-528s21c1
Sequence:CCGGGGAACTGAACGTCACGGTGGTCTCGAGACCACCGTGACGTTCAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011178
PRTN3 MISSION shRNA shRNA Plasmid DNA
proteinase 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011178.2-815s1c1
Sequence:CCGGCCAGCAGGCTCTAGTGGGAAACTCGAGTTTCCCACTAGAGCCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011178.2-631s1c1
Sequence:CCGGCCCTTGATCTGCAATGGCATTCTCGAGAATGCCATTGCAGATCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011178.2-647s1c1
Sequence:CCGGGCATTCTTCATGGAGTGGACTCTCGAGAGTCCACTCCATGAAGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011178.2-323s1c1
Sequence:CCGGGTCAGGTCTTCCAGAACAATTCTCGAGAATTGTTCTGGAAGACCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011178.2-355s1c1
Sequence:CCGGGAGAACCTCAATGACGTGCTTCTCGAGAAGCACGTCATTGAGGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011178.2-190s21c1
Sequence:CCGGACCCTGATCCACCCGAGATTCCTCGAGGAATCTCGGGTGGATCAGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011178.2-528s21c1
Sequence:CCGGGGAACTGAACGTCACGGTGGTCTCGAGACCACCGTGACGTTCAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011178
PRTN3 MISSION shRNA Lentiviral Transduction Particles
proteinase 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011178.2-815s1c1
Sequence:CCGGCCAGCAGGCTCTAGTGGGAAACTCGAGTTTCCCACTAGAGCCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011178.2-631s1c1
Sequence:CCGGCCCTTGATCTGCAATGGCATTCTCGAGAATGCCATTGCAGATCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011178.2-647s1c1
Sequence:CCGGGCATTCTTCATGGAGTGGACTCTCGAGAGTCCACTCCATGAAGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011178.2-323s1c1
Sequence:CCGGGTCAGGTCTTCCAGAACAATTCTCGAGAATTGTTCTGGAAGACCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011178.2-355s1c1
Sequence:CCGGGAGAACCTCAATGACGTGCTTCTCGAGAAGCACGTCATTGAGGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011178.2-190s21c1
Sequence:CCGGACCCTGATCCACCCGAGATTCCTCGAGGAATCTCGGGTGGATCAGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011178.2-528s21c1
Sequence:CCGGGGAACTGAACGTCACGGTGGTCTCGAGACCACCGTGACGTTCAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)