EMAIL THIS PAGE TO A FRIEND

PRY

PTPN13-like, Y-linked

15 Gene Product Result for
Synonyms: PRY1 PTPN13LY
Species: Human PRY(9081)
UniProtKB ID: O14603, B7ZLM1, Q14D09
Gene ID:
Human(9081) Summary: This gene is located in the nonrecombining portion of the Y chromosome, and expressed specifically in testis. It encodes a protein which has a low degree of similarity to protein tyrosine phosphatase, non-receptor type 13. Two nearly identical copies of this gene exist within a palindromic region. This record represents the more telomeric copy. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004676 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004676 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070662 predicted 278
2 SASI_Hs01_00070663 predicted 449
3 SASI_Hs01_00070664 predicted 582
4 SASI_Hs01_00070665 predicted 1010
5 SASI_Hs01_00070666 predicted 382
6 SASI_Hs01_00070667 predicted 687
7 SASI_Hs01_00070668 predicted 369
8 SASI_Hs01_00070669 predicted 801
9 SASI_Hs01_00070670 predicted 665
10 SASI_Hs01_00070671 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004676
PRY MISSION shRNA Bacterial Glycerol Stock
PTPN13-like, Y-linked
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004676.2-288s1c1
Sequence:CCGGGACTGCCAGGGATGCAATATTCTCGAGAATATTGCATCCCTGGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004676.2-554s1c1
Sequence:CCGGGAGAAGCAGGTTATCTTCACACTCGAGTGTGAAGATAACCTGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004676.2-374s1c1
Sequence:CCGGCAGAAGGAAGAAGGATCTTAACTCGAGTTAAGATCCTTCTTCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004676.2-652s1c1
Sequence:CCGGACGTTCATGAAGAAGACTAAGCTCGAGCTTAGTCTTCTTCATGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004676.2-962s1c1
Sequence:CCGGGCCTCCAATTCTGACCTTACACTCGAGTGTAAGGTCAGAATTGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004676
PRY MISSION shRNA shRNA Plasmid DNA
PTPN13-like, Y-linked
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004676.2-288s1c1
Sequence:CCGGGACTGCCAGGGATGCAATATTCTCGAGAATATTGCATCCCTGGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004676.2-554s1c1
Sequence:CCGGGAGAAGCAGGTTATCTTCACACTCGAGTGTGAAGATAACCTGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004676.2-374s1c1
Sequence:CCGGCAGAAGGAAGAAGGATCTTAACTCGAGTTAAGATCCTTCTTCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004676.2-652s1c1
Sequence:CCGGACGTTCATGAAGAAGACTAAGCTCGAGCTTAGTCTTCTTCATGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004676.2-962s1c1
Sequence:CCGGGCCTCCAATTCTGACCTTACACTCGAGTGTAAGGTCAGAATTGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004676
PRY MISSION shRNA Lentiviral Transduction Particles
PTPN13-like, Y-linked
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004676.2-288s1c1
Sequence:CCGGGACTGCCAGGGATGCAATATTCTCGAGAATATTGCATCCCTGGCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004676.2-554s1c1
Sequence:CCGGGAGAAGCAGGTTATCTTCACACTCGAGTGTGAAGATAACCTGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004676.2-374s1c1
Sequence:CCGGCAGAAGGAAGAAGGATCTTAACTCGAGTTAAGATCCTTCTTCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004676.2-652s1c1
Sequence:CCGGACGTTCATGAAGAAGACTAAGCTCGAGCTTAGTCTTCTTCATGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004676.2-962s1c1
Sequence:CCGGGCCTCCAATTCTGACCTTACACTCGAGTGTAAGGTCAGAATTGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)