EMAIL THIS PAGE TO A FRIEND

PSAP

prosaposin

69 Gene Product Result for
Synonyms: GLBA SAP1
Gene ID:
Human(5660) Summary: This gene encodes a highly conserved glycoprotein which is a precursor for 4 cleavage products: saposins A, B, C, and D. Each domain of the precursor protein is approximately 80 amino acid residues long with nearly identical placement of cysteine residues and glycosylation sites. Saposins A-D localize primarily to the lysosomal compartment where they facilitate the catabolism of glycosphingolipids with short oligosaccharide groups. The precursor protein exists both as a secretory protein and as an integral membrane protein and has neurotrophic activities. Mutations in this gene have been associated with Gaucher disease, Tay-Sachs disease, and metachromatic leukodystrophy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(19156) prosaposin
Rat(25524) prosaposin
Zebrafish(140811) prosaposin
Horse(100063520) prosaposin
dog(479240) prosaposin
chicken(395602) prosaposin
cow(281433) prosaposin
sheep(100135695) prosaposin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002778 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042465 Rosetta Predictions human pricing
NM_001042466 Rosetta Predictions human pricing
NM_002778 Rosetta Predictions human pricing
NM_013013 Rosetta Predictions rat pricing
NM_011179 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309928 predicted 322 143.00
2 SASI_Hs02_00309929 predicted 1519 143.00
3 SASI_Hs02_00309930 predicted 1712 143.00
4 SASI_Hs02_00309931 predicted 359 143.00
5 SASI_Hs02_00309932 predicted 1563 143.00
6 SASI_Hs02_00309933 predicted 255 143.00
7 SASI_Hs02_00309934 predicted 569 143.00
8 SASI_Hs02_00309935 predicted 1094 143.00
9 SASI_Hs02_00309936 predicted 1567 143.00
10 SASI_Hs02_00309937 predicted 317 143.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309938 predicted 317 143.00
2 SASI_Hs02_00309939 predicted 1520 143.00
3 SASI_Hs02_00309940 predicted 1708 143.00
4 SASI_Hs02_00309941 predicted 360 143.00
5 SASI_Hs02_00309942 predicted 1564 143.00
6 SASI_Hs02_00309943 predicted 252 143.00
7 SASI_Hs02_00309944 predicted 570 143.00
8 SASI_Hs02_00309945 predicted 1082 143.00
9 SASI_Hs02_00309946 predicted 1558 143.00
10 SASI_Hs02_00309947 predicted 316 143.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334411 predicted 323 143.00
2 SASI_Hs01_00128988 predicted 1516 143.00
3 SASI_Hs01_00128990 predicted 1702 143.00
4 SASI_Hs02_00334412 predicted 355 143.00
5 SASI_Hs01_00128995 predicted 1552 143.00
6 SASI_Hs02_00334413 predicted 257 143.00
7 SASI_Hs02_00334414 predicted 566 143.00
8 SASI_Hs02_00334415 predicted 1083 143.00
9 SASI_Hs02_00334416 predicted 1554 143.00
10 SASI_Hs02_00334417 predicted 315 143.00
11 SASI_Hs01_00128986 predicted 1692 143.00
12 SASI_Hs01_00128987 predicted 789 143.00
13 SASI_Hs01_00128989 predicted 627 143.00
14 SASI_Hs01_00128991 predicted 771 143.00
15 SASI_Hs01_00128992 predicted 755 143.00
16 SASI_Hs01_00128993 predicted 963 143.00
17 SASI_Hs01_00128994 predicted 645 143.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053869 predicted 932 143.00
2 SASI_Rn01_00053870 predicted 1250 143.00
3 SASI_Rn01_00053871 predicted 1733 143.00
4 SASI_Rn02_00260672 predicted 996 143.00
5 SASI_Rn01_00053872 predicted 1025 143.00
6 SASI_Rn01_00053873 predicted 1661 143.00
7 SASI_Rn01_00053874 predicted 1729 143.00
8 SASI_Rn01_00053875 predicted 748 143.00
9 SASI_Rn01_00053876 predicted 1708 143.00
10 SASI_Rn01_00053877 predicted 1153 143.00
11 SASI_Rn01_00053878 predicted 302 143.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029010 predicted 1716 143.00
2 SASI_Mm01_00029011 predicted 1021 143.00
3 SASI_Mm01_00029012 predicted 1643 143.00
4 SASI_Mm01_00029013 predicted 1598 143.00
5 SASI_Mm01_00029014 predicted 427 143.00
6 SASI_Mm01_00029015 predicted 731 143.00
7 SASI_Mm01_00029016 predicted 707 143.00
8 SASI_Mm01_00029017 predicted 1696 143.00
9 SASI_Mm01_00029018 predicted 1709 143.00
10 SASI_Mm01_00029019 predicted 1465 143.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002778
VALIDATED
PSAP MISSION shRNA Bacterial Glycerol Stock
prosaposin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-830s21c1
Sequence:GTACCGGGAACTATATCAGCCAGTATTCCTCGAGGAATACTGGCTGATATAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002778.1-2153s1c1
Sequence:CCGGCCACTGTAATAGCATAGGGATCTCGAGATCCCTATGCTATTACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002778.1-775s1c1
Sequence:CCGGGCCAGTATTCTGAAATTGCTACTCGAGTAGCAATTTCAGAATACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002778.1-344s1c1
Sequence:CCGGGTCTGCTTCATGCAAGGAGATCTCGAGATCTCCTTGCATGAAGCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002778.1-1374s1c1
Sequence:CCGGCCTTACCAGAAGCAGTGTGATCTCGAGATCACACTGCTTCTGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002778.1-752s1c1
Sequence:CCGGCGACATATGCAAGAACTATATCTCGAGATATAGTTCTTGCATATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-2214s21c1
Sequence:CCGGACTGTAATAGCATAGGGATTTCTCGAGAAATCCCTATGCTATTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-993s21c1
Sequence:CCGGGAACTGGTGGAGCCCATTAAGCTCGAGCTTAATGGGCTCCACCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-557s21c1
Sequence:CCGGGAAGCAGCTGGAGTCCAATAACTCGAGTTATTGGACTCCAGCTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-448s21c1
Sequence:CCGGCTGTCATCCTGGACATCATTACTCGAGTAATGATGTCCAGGATGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002778
VALIDATED
PSAP MISSION shRNA shRNA Plasmid DNA
prosaposin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-830s21c1
Sequence:GTACCGGGAACTATATCAGCCAGTATTCCTCGAGGAATACTGGCTGATATAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002778.1-2153s1c1
Sequence:CCGGCCACTGTAATAGCATAGGGATCTCGAGATCCCTATGCTATTACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002778.1-775s1c1
Sequence:CCGGGCCAGTATTCTGAAATTGCTACTCGAGTAGCAATTTCAGAATACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002778.1-344s1c1
Sequence:CCGGGTCTGCTTCATGCAAGGAGATCTCGAGATCTCCTTGCATGAAGCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002778.1-1374s1c1
Sequence:CCGGCCTTACCAGAAGCAGTGTGATCTCGAGATCACACTGCTTCTGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002778.1-752s1c1
Sequence:CCGGCGACATATGCAAGAACTATATCTCGAGATATAGTTCTTGCATATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-2214s21c1
Sequence:CCGGACTGTAATAGCATAGGGATTTCTCGAGAAATCCCTATGCTATTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-993s21c1
Sequence:CCGGGAACTGGTGGAGCCCATTAAGCTCGAGCTTAATGGGCTCCACCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-557s21c1
Sequence:CCGGGAAGCAGCTGGAGTCCAATAACTCGAGTTATTGGACTCCAGCTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-448s21c1
Sequence:CCGGCTGTCATCCTGGACATCATTACTCGAGTAATGATGTCCAGGATGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002778
VALIDATED
PSAP MISSION shRNA Lentiviral Transduction Particles
prosaposin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-830s21c1
Sequence:GTACCGGGAACTATATCAGCCAGTATTCCTCGAGGAATACTGGCTGATATAGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002778.1-2153s1c1
Sequence:CCGGCCACTGTAATAGCATAGGGATCTCGAGATCCCTATGCTATTACAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002778.1-775s1c1
Sequence:CCGGGCCAGTATTCTGAAATTGCTACTCGAGTAGCAATTTCAGAATACTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002778.1-344s1c1
Sequence:CCGGGTCTGCTTCATGCAAGGAGATCTCGAGATCTCCTTGCATGAAGCAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002778.1-1374s1c1
Sequence:CCGGCCTTACCAGAAGCAGTGTGATCTCGAGATCACACTGCTTCTGGTAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002778.1-752s1c1
Sequence:CCGGCGACATATGCAAGAACTATATCTCGAGATATAGTTCTTGCATATGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-2214s21c1
Sequence:CCGGACTGTAATAGCATAGGGATTTCTCGAGAAATCCCTATGCTATTACAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-993s21c1
Sequence:CCGGGAACTGGTGGAGCCCATTAAGCTCGAGCTTAATGGGCTCCACCAGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-557s21c1
Sequence:CCGGGAAGCAGCTGGAGTCCAATAACTCGAGTTATTGGACTCCAGCTGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002778.2-448s21c1
Sequence:CCGGCTGTCATCCTGGACATCATTACTCGAGTAATGATGTCCAGGATGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011179
VALIDATED
PSAP MISSION shRNA Bacterial Glycerol Stock
prosaposin
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011179.2-1339s1c1
Sequence:CCGGGCAAGAAACTGGTCCTCTATTCTCGAGAATAGAGGACCAGTTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011179.2-1781s1c1
Sequence:CCGGCCTCTCCCTTACTGTAGCATTCTCGAGAATGCTACAGTAAGGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011179.2-1518s1c1
Sequence:CCGGCCTGGATTTGTGTGCTCGAAACTCGAGTTTCGAGCACACAAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011179.2-1022s1c1
Sequence:CCGGCCTAGTTAAAGGTTTGAGCAACTCGAGTTGCTCAAACCTTTAACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011179.2-1107s1c1
Sequence:CCGGCCCTCCCTGTTGGACATCTTTCTCGAGAAAGATGTCCAACAGGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011179.3-1891s21c1
Sequence:CCGGCCTCTCCCTTACTGTAGCATTCTCGAGAATGCTACAGTAAGGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011179.3-1121s21c1
Sequence:CCGGACTGAGGAGCTCCTAGTTAAACTCGAGTTTAACTAGGAGCTCCTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011179.3-459s21c1
Sequence:CCGGCTGTCATCCTGGACATGATTACTCGAGTAATCATGTCCAGGATGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011179.3-1628s21c1
Sequence:CCGGCCTGGATTTGTGTGCTCGAAACTCGAGTTTCGAGCACACAAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011179.3-838s21c1
Sequence:CCGGGAACTACGTGGACCAGTATTCCTCGAGGAATACTGGTCCACGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011179.3-1449s21c1
Sequence:CCGGGCAAGAAACTGGTCCTCTATTCTCGAGAATAGAGGACCAGTTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011179
VALIDATED
PSAP MISSION shRNA shRNA Plasmid DNA
prosaposin
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011179.2-1339s1c1
Sequence:CCGGGCAAGAAACTGGTCCTCTATTCTCGAGAATAGAGGACCAGTTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011179.2-1781s1c1
Sequence:CCGGCCTCTCCCTTACTGTAGCATTCTCGAGAATGCTACAGTAAGGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011179.2-1518s1c1
Sequence:CCGGCCTGGATTTGTGTGCTCGAAACTCGAGTTTCGAGCACACAAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011179.2-1022s1c1
Sequence:CCGGCCTAGTTAAAGGTTTGAGCAACTCGAGTTGCTCAAACCTTTAACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011179.2-1107s1c1
Sequence:CCGGCCCTCCCTGTTGGACATCTTTCTCGAGAAAGATGTCCAACAGGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011179.3-1891s21c1
Sequence:CCGGCCTCTCCCTTACTGTAGCATTCTCGAGAATGCTACAGTAAGGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011179.3-1121s21c1
Sequence:CCGGACTGAGGAGCTCCTAGTTAAACTCGAGTTTAACTAGGAGCTCCTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011179.3-459s21c1
Sequence:CCGGCTGTCATCCTGGACATGATTACTCGAGTAATCATGTCCAGGATGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011179.3-1628s21c1
Sequence:CCGGCCTGGATTTGTGTGCTCGAAACTCGAGTTTCGAGCACACAAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011179.3-838s21c1
Sequence:CCGGGAACTACGTGGACCAGTATTCCTCGAGGAATACTGGTCCACGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011179.3-1449s21c1
Sequence:CCGGGCAAGAAACTGGTCCTCTATTCTCGAGAATAGAGGACCAGTTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011179
VALIDATED
PSAP MISSION shRNA Lentiviral Transduction Particles
prosaposin
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011179.2-1339s1c1
Sequence:CCGGGCAAGAAACTGGTCCTCTATTCTCGAGAATAGAGGACCAGTTTCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011179.2-1781s1c1
Sequence:CCGGCCTCTCCCTTACTGTAGCATTCTCGAGAATGCTACAGTAAGGGAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011179.2-1518s1c1
Sequence:CCGGCCTGGATTTGTGTGCTCGAAACTCGAGTTTCGAGCACACAAATCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011179.2-1022s1c1
Sequence:CCGGCCTAGTTAAAGGTTTGAGCAACTCGAGTTGCTCAAACCTTTAACTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011179.2-1107s1c1
Sequence:CCGGCCCTCCCTGTTGGACATCTTTCTCGAGAAAGATGTCCAACAGGGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011179.3-1891s21c1
Sequence:CCGGCCTCTCCCTTACTGTAGCATTCTCGAGAATGCTACAGTAAGGGAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011179.3-1121s21c1
Sequence:CCGGACTGAGGAGCTCCTAGTTAAACTCGAGTTTAACTAGGAGCTCCTCAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011179.3-459s21c1
Sequence:CCGGCTGTCATCCTGGACATGATTACTCGAGTAATCATGTCCAGGATGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011179.3-1628s21c1
Sequence:CCGGCCTGGATTTGTGTGCTCGAAACTCGAGTTTCGAGCACACAAATCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011179.3-838s21c1
Sequence:CCGGGAACTACGTGGACCAGTATTCCTCGAGGAATACTGGTCCACGTAGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011179.3-1449s21c1
Sequence:CCGGGCAAGAAACTGGTCCTCTATTCTCGAGAATAGAGGACCAGTTTCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)