EMAIL THIS PAGE TO A FRIEND

PSAPL1

prosaposin-like 1 (gene/pseudogene)

158 Gene Product Result for
UniProtKB ID: Q6NUJ1, A0A184, Q8N7T4
Gene ID:
Mouse(76943) prosaposin-like 1
Rat(289720) prosaposin-like 1
cow(529295) prosaposin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175249 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175249 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175249 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001085382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085382 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085382 Rosetta Predictions human pricing
NM_175249 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317546 predicted 961
2 SASI_Hs02_00317547 predicted 279
3 SASI_Hs02_00317548 predicted 1387
4 SASI_Hs02_00317549 predicted 977
5 SASI_Hs02_00317550 predicted 1439
6 SASI_Hs02_00317551 predicted 344
7 SASI_Hs02_00317552 predicted 1429
8 SASI_Hs02_00317553 predicted 247
9 SASI_Hs02_00317554 predicted 944
10 SASI_Hs02_00317555 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345942 predicted 2016
2 SASI_Mm02_00345943 predicted 212
3 SASI_Mm01_00104877 predicted 1382
4 SASI_Mm01_00104878 predicted 900
5 SASI_Mm02_00345944 predicted 1922
6 SASI_Mm02_00345945 predicted 1639
7 SASI_Mm02_00345946 predicted 1081
8 SASI_Mm02_00345947 predicted 1348
9 SASI_Mm02_00345948 predicted 942
10 SASI_Mm02_00345949 predicted 1474
11 SASI_Mm01_00104871 predicted 263
12 SASI_Mm01_00104872 predicted 1065
13 SASI_Mm01_00104873 predicted 1437
14 SASI_Mm01_00104874 predicted 338
15 SASI_Mm01_00104875 predicted 1329
16 SASI_Mm01_00104876 predicted 1110
17 SASI_Mm01_00104879 predicted 882
18 SASI_Mm01_00104880 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175249
PSAPL1 MISSION shRNA Bacterial Glycerol Stock
prosaposin-like 1 (gene/pseudogene)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175249.3-1781s21c1
Sequence:CCGGAGTTGGGCAGTGTCGTCTTTCCTCGAGGAAAGACGACACTGCCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175249.3-740s21c1
Sequence:CCGGACTACATCCACCGGCAGTTTGCTCGAGCAAACTGCCGGTGGATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175249.3-296s21c1
Sequence:CCGGGTGCTACAGAGTCGGATATTTCTCGAGAAATATCCGACTCTGTAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175249.3-1538s21c1
Sequence:CCGGAGGCCGCTGAAATGTGTAATGCTCGAGCATTACACATTTCAGCGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175249.2-440s1c1
Sequence:CCGGGAACCATTACAGAGGCACCTACTCGAGTAGGTGCCTCTGTAATGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175249.2-1042s1c1
Sequence:CCGGAGACACCTACAGCCCTGAATTCTCGAGAATTCAGGGCTGTAGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175249.2-1367s1c1
Sequence:CCGGGCTCATAGAGAGCCTCAAGTTCTCGAGAACTTGAGGCTCTCTATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175249.2-865s1c1
Sequence:CCGGGAGGACGAATGAGTTGCAGATCTCGAGATCTGCAACTCATTCGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175249.2-1319s1c1
Sequence:CCGGGCCTTATGTGATGCACTGCAACTCGAGTTGCAGTGCATCACATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175249.3-648s21c1
Sequence:CCGGGGATGCTCTAGAGTCTAATTTCTCGAGAAATTAGACTCTAGAGCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175249
PSAPL1 MISSION shRNA shRNA Plasmid DNA
prosaposin-like 1 (gene/pseudogene)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175249.3-1781s21c1
Sequence:CCGGAGTTGGGCAGTGTCGTCTTTCCTCGAGGAAAGACGACACTGCCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175249.3-740s21c1
Sequence:CCGGACTACATCCACCGGCAGTTTGCTCGAGCAAACTGCCGGTGGATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175249.3-296s21c1
Sequence:CCGGGTGCTACAGAGTCGGATATTTCTCGAGAAATATCCGACTCTGTAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175249.3-1538s21c1
Sequence:CCGGAGGCCGCTGAAATGTGTAATGCTCGAGCATTACACATTTCAGCGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175249.2-440s1c1
Sequence:CCGGGAACCATTACAGAGGCACCTACTCGAGTAGGTGCCTCTGTAATGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175249.2-1042s1c1
Sequence:CCGGAGACACCTACAGCCCTGAATTCTCGAGAATTCAGGGCTGTAGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175249.2-1367s1c1
Sequence:CCGGGCTCATAGAGAGCCTCAAGTTCTCGAGAACTTGAGGCTCTCTATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175249.2-865s1c1
Sequence:CCGGGAGGACGAATGAGTTGCAGATCTCGAGATCTGCAACTCATTCGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175249.2-1319s1c1
Sequence:CCGGGCCTTATGTGATGCACTGCAACTCGAGTTGCAGTGCATCACATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175249.3-648s21c1
Sequence:CCGGGGATGCTCTAGAGTCTAATTTCTCGAGAAATTAGACTCTAGAGCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175249
PSAPL1 MISSION shRNA Lentiviral Transduction Particles
prosaposin-like 1 (gene/pseudogene)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175249.3-1781s21c1
Sequence:CCGGAGTTGGGCAGTGTCGTCTTTCCTCGAGGAAAGACGACACTGCCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175249.3-740s21c1
Sequence:CCGGACTACATCCACCGGCAGTTTGCTCGAGCAAACTGCCGGTGGATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175249.3-296s21c1
Sequence:CCGGGTGCTACAGAGTCGGATATTTCTCGAGAAATATCCGACTCTGTAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175249.3-1538s21c1
Sequence:CCGGAGGCCGCTGAAATGTGTAATGCTCGAGCATTACACATTTCAGCGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175249.2-440s1c1
Sequence:CCGGGAACCATTACAGAGGCACCTACTCGAGTAGGTGCCTCTGTAATGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175249.2-1042s1c1
Sequence:CCGGAGACACCTACAGCCCTGAATTCTCGAGAATTCAGGGCTGTAGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175249.2-1367s1c1
Sequence:CCGGGCTCATAGAGAGCCTCAAGTTCTCGAGAACTTGAGGCTCTCTATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175249.2-865s1c1
Sequence:CCGGGAGGACGAATGAGTTGCAGATCTCGAGATCTGCAACTCATTCGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175249.2-1319s1c1
Sequence:CCGGGCCTTATGTGATGCACTGCAACTCGAGTTGCAGTGCATCACATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175249.3-648s21c1
Sequence:CCGGGGATGCTCTAGAGTCTAATTTCTCGAGAAATTAGACTCTAGAGCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085382
PSAPL1 MISSION shRNA Bacterial Glycerol Stock
prosaposin-like 1 (gene/pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085382.1-1603s21c1
Sequence:CCGGACACTGCCAGAAGCATGTATGCTCGAGCATACATGCTTCTGGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085382.1-1024s21c1
Sequence:CCGGCAACAGCTCTGAGCTCATGATCTCGAGATCATGAGCTCAGAGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085382.1-696s21c1
Sequence:CCGGACTTGACCTTGGCCGACTTGACTCGAGTCAAGTCGGCCAAGGTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085382.1-1089s21c1
Sequence:CCGGTCACGAAGGAGTGCATCATCTCTCGAGAGATGATGCACTCCTTCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085382.1-3040s21c1
Sequence:CCGGACCTGAGGCCCATGGATTAATCTCGAGATTAATCCATGGGCCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085382
PSAPL1 MISSION shRNA shRNA Plasmid DNA
prosaposin-like 1 (gene/pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085382.1-1603s21c1
Sequence:CCGGACACTGCCAGAAGCATGTATGCTCGAGCATACATGCTTCTGGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085382.1-1024s21c1
Sequence:CCGGCAACAGCTCTGAGCTCATGATCTCGAGATCATGAGCTCAGAGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085382.1-696s21c1
Sequence:CCGGACTTGACCTTGGCCGACTTGACTCGAGTCAAGTCGGCCAAGGTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085382.1-1089s21c1
Sequence:CCGGTCACGAAGGAGTGCATCATCTCTCGAGAGATGATGCACTCCTTCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085382.1-3040s21c1
Sequence:CCGGACCTGAGGCCCATGGATTAATCTCGAGATTAATCCATGGGCCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085382
PSAPL1 MISSION shRNA Lentiviral Transduction Particles
prosaposin-like 1 (gene/pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085382.1-1603s21c1
Sequence:CCGGACACTGCCAGAAGCATGTATGCTCGAGCATACATGCTTCTGGCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085382.1-1024s21c1
Sequence:CCGGCAACAGCTCTGAGCTCATGATCTCGAGATCATGAGCTCAGAGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085382.1-696s21c1
Sequence:CCGGACTTGACCTTGGCCGACTTGACTCGAGTCAAGTCGGCCAAGGTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085382.1-1089s21c1
Sequence:CCGGTCACGAAGGAGTGCATCATCTCTCGAGAGATGATGCACTCCTTCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085382.1-3040s21c1
Sequence:CCGGACCTGAGGCCCATGGATTAATCTCGAGATTAATCCATGGGCCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)