EMAIL THIS PAGE TO A FRIEND

PSAT1

phosphoserine aminotransferase 1

69 Gene Product Result for
Synonyms: EPIP PSA PSAT
UniProtKB ID: Q9Y617, Q5T7G5, Q5T7G6, Q96AW2, Q9BQ12
Gene ID:
Human(29968) Summary: The protein encoded by this gene is likely a phosphoserine aminotransferase, based on similarity to proteins in mouse, rabbit, and Drosophila. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(107272) phosphoserine aminotransferase 1
Rat(293820) phosphoserine aminotransferase 1
Thale Cress(839335) phospholipid sterol acyl transferase 1
chicken(427263) phosphoserine aminotransferase 1
Zebrafish(327512) phosphoserine aminotransferase 1
domestic cat(101095525) phosphoserine aminotransferase 1
Horse(100061380) phosphoserine aminotransferase 1
dog(476318) phosphoserine aminotransferase 1
cow(533044) phosphoserine aminotransferase 1
sheep(101120382) phosphoserine aminotransferase 1
domestic guinea pig(100731576) phosphoserine aminotransferase 1
Domestic Rabbit(100009099) phosphoserine aminotransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021154 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021154 Rosetta Predictions human pricing
NM_058179 Rosetta Predictions human pricing
NM_198738 Rosetta Predictions rat pricing
NM_177420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243316 predicted 415
2 SASI_Hs02_00354694 predicted 1532
3 SASI_Hs01_00243317 predicted 1483
4 SASI_Hs02_00354695 predicted 408
5 SASI_Hs02_00354696 predicted 1535
6 SASI_Hs02_00354697 predicted 387
7 SASI_Hs01_00243319 predicted 1220
8 SASI_Hs02_00354698 predicted 1146
9 SASI_Hs01_00243321 predicted 1201
10 SASI_Hs01_00243323 predicted 266
11 SASI_Hs01_00243315 predicted 1217
12 SASI_Hs01_00243318 predicted 440
13 SASI_Hs01_00243320 predicted 550
14 SASI_Hs01_00243322 predicted 582
15 SASI_Hs01_00243324 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206942 predicted 412
2 SASI_Hs02_00362087 predicted 1677
3 SASI_Hs01_00206943 predicted 1625
4 SASI_Hs02_00362088 predicted 405
5 SASI_Hs02_00362089 predicted 1670
6 SASI_Hs02_00362090 predicted 383
7 SASI_Hs01_00206945 predicted 1363
8 SASI_Hs02_00362091 predicted 1282
9 SASI_Hs01_00206947 predicted 1337
10 SASI_Hs01_00206949 predicted 265
11 SASI_Hs01_00206941 predicted 1364
12 SASI_Hs01_00206944 predicted 448
13 SASI_Hs01_00206946 predicted 558
14 SASI_Hs01_00206948 predicted 585
15 SASI_Hs01_00206950 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269956 predicted 756
2 SASI_Rn02_00269957 predicted 359
3 SASI_Rn01_00107918 predicted 1205
4 SASI_Rn01_00107919 predicted 830
5 SASI_Rn02_00269958 predicted 681
6 SASI_Rn01_00107920 predicted 716
7 SASI_Rn02_00269959 predicted 572
8 SASI_Rn02_00269960 predicted 212
9 SASI_Rn02_00269961 predicted 1071
10 SASI_Rn02_00269962 predicted 208
11 SASI_Rn01_00107917 predicted 1128
12 SASI_Rn01_00107921 predicted 839
13 SASI_Rn01_00107922 predicted 843
14 SASI_Rn01_00107923 predicted 842
15 SASI_Rn01_00107924 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154511 predicted 915
2 SASI_Mm01_00154503 predicted 774
3 SASI_Mm01_00154504 predicted 441
4 SASI_Mm01_00154512 predicted 622
5 SASI_Mm01_00154505 predicted 455
6 SASI_Mm01_00154506 predicted 372
7 SASI_Mm02_00347629 predicted 219
8 SASI_Mm02_00347630 predicted 299
9 SASI_Mm01_00154507 predicted 472
10 SASI_Mm02_00347631 predicted 838
11 SASI_Mm01_00154508 predicted 462
12 SASI_Mm01_00154509 predicted 420
13 SASI_Mm01_00154510 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021154
VALIDATED
PSAT1 MISSION shRNA Bacterial Glycerol Stock
phosphoserine aminotransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-411s21c1
Sequence:CCGGGCCAAGAAGTTTGGGACTATACTCGAGTATAGTCCCAAACTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-267s1c1
Sequence:CCGGCCAGACAACTATAAGGTGATTCTCGAGAATCACCTTATAGTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-411s1c1
Sequence:CCGGGCCAAGAAGTTTGGGACTATACTCGAGTATAGTCCCAAACTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-630s1c1
Sequence:CCGGGTTTCCAAGTTTGGTGTGATTCTCGAGAATCACACCAAACTTGGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-122s1c1
Sequence:CCGGGCACTCAGTGTTGTTAGAGATCTCGAGATCTCTAACAACACTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-881s1c1
Sequence:CCGGCTCCATCAAATCTCAAACAATCTCGAGATTGTTTGAGATTTGATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-122s21c1
Sequence:CCGGGCACTCAGTGTTGTTAGAGATCTCGAGATCTCTAACAACACTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-267s21c1
Sequence:CCGGCCAGACAACTATAAGGTGATTCTCGAGAATCACCTTATAGTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-630s21c1
Sequence:CCGGGTTTCCAAGTTTGGTGTGATTCTCGAGAATCACACCAAACTTGGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-881s21c1
Sequence:CCGGCTCCATCAAATCTCAAACAATCTCGAGATTGTTTGAGATTTGATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021154
VALIDATED
PSAT1 MISSION shRNA shRNA Plasmid DNA
phosphoserine aminotransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-411s21c1
Sequence:CCGGGCCAAGAAGTTTGGGACTATACTCGAGTATAGTCCCAAACTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-267s1c1
Sequence:CCGGCCAGACAACTATAAGGTGATTCTCGAGAATCACCTTATAGTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-411s1c1
Sequence:CCGGGCCAAGAAGTTTGGGACTATACTCGAGTATAGTCCCAAACTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-630s1c1
Sequence:CCGGGTTTCCAAGTTTGGTGTGATTCTCGAGAATCACACCAAACTTGGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-122s1c1
Sequence:CCGGGCACTCAGTGTTGTTAGAGATCTCGAGATCTCTAACAACACTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-881s1c1
Sequence:CCGGCTCCATCAAATCTCAAACAATCTCGAGATTGTTTGAGATTTGATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-122s21c1
Sequence:CCGGGCACTCAGTGTTGTTAGAGATCTCGAGATCTCTAACAACACTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-267s21c1
Sequence:CCGGCCAGACAACTATAAGGTGATTCTCGAGAATCACCTTATAGTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-630s21c1
Sequence:CCGGGTTTCCAAGTTTGGTGTGATTCTCGAGAATCACACCAAACTTGGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-881s21c1
Sequence:CCGGCTCCATCAAATCTCAAACAATCTCGAGATTGTTTGAGATTTGATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021154
VALIDATED
PSAT1 MISSION shRNA Lentiviral Transduction Particles
phosphoserine aminotransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-411s21c1
Sequence:CCGGGCCAAGAAGTTTGGGACTATACTCGAGTATAGTCCCAAACTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-267s1c1
Sequence:CCGGCCAGACAACTATAAGGTGATTCTCGAGAATCACCTTATAGTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-411s1c1
Sequence:CCGGGCCAAGAAGTTTGGGACTATACTCGAGTATAGTCCCAAACTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-630s1c1
Sequence:CCGGGTTTCCAAGTTTGGTGTGATTCTCGAGAATCACACCAAACTTGGAAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-122s1c1
Sequence:CCGGGCACTCAGTGTTGTTAGAGATCTCGAGATCTCTAACAACACTGAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021154.3-881s1c1
Sequence:CCGGCTCCATCAAATCTCAAACAATCTCGAGATTGTTTGAGATTTGATGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-122s21c1
Sequence:CCGGGCACTCAGTGTTGTTAGAGATCTCGAGATCTCTAACAACACTGAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-267s21c1
Sequence:CCGGCCAGACAACTATAAGGTGATTCTCGAGAATCACCTTATAGTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-630s21c1
Sequence:CCGGGTTTCCAAGTTTGGTGTGATTCTCGAGAATCACACCAAACTTGGAAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_021154.3-881s21c1
Sequence:CCGGCTCCATCAAATCTCAAACAATCTCGAGATTGTTTGAGATTTGATGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177420
VALIDATED
PSAT1 MISSION shRNA Bacterial Glycerol Stock
phosphoserine aminotransferase 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177420.1-474s1c1
Sequence:CCGGCCACCCTAAACTTGGAAGTTACTCGAGTAACTTCCAAGTTTAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177420.1-775s1c1
Sequence:CCGGCCATCAGTCCTTGACTACAAACTCGAGTTTGTAGTCAAGGACTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177420.1-156s1c1
Sequence:CCGGACACTCGGTATTGTTGGAGATCTCGAGATCTCCAACAATACCGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177420.1-775s21c1
Sequence:CCGGCCATCAGTCCTTGACTACAAACTCGAGTTTGTAGTCAAGGACTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177420.1-1695s1c1
Sequence:CCGGGCTGTGTTTATGTAGTGGGTACTCGAGTACCCACTACATAAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177420.1-156s21c1
Sequence:CCGGACACTCGGTATTGTTGGAGATCTCGAGATCTCCAACAATACCGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177420.1-1695s21c1
Sequence:CCGGGCTGTGTTTATGTAGTGGGTACTCGAGTACCCACTACATAAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177420
VALIDATED
PSAT1 MISSION shRNA shRNA Plasmid DNA
phosphoserine aminotransferase 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177420.1-474s1c1
Sequence:CCGGCCACCCTAAACTTGGAAGTTACTCGAGTAACTTCCAAGTTTAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177420.1-775s1c1
Sequence:CCGGCCATCAGTCCTTGACTACAAACTCGAGTTTGTAGTCAAGGACTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177420.1-156s1c1
Sequence:CCGGACACTCGGTATTGTTGGAGATCTCGAGATCTCCAACAATACCGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177420.1-775s21c1
Sequence:CCGGCCATCAGTCCTTGACTACAAACTCGAGTTTGTAGTCAAGGACTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177420.1-1695s1c1
Sequence:CCGGGCTGTGTTTATGTAGTGGGTACTCGAGTACCCACTACATAAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177420.1-156s21c1
Sequence:CCGGACACTCGGTATTGTTGGAGATCTCGAGATCTCCAACAATACCGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177420.1-1695s21c1
Sequence:CCGGGCTGTGTTTATGTAGTGGGTACTCGAGTACCCACTACATAAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177420
VALIDATED
PSAT1 MISSION shRNA Lentiviral Transduction Particles
phosphoserine aminotransferase 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177420.1-474s1c1
Sequence:CCGGCCACCCTAAACTTGGAAGTTACTCGAGTAACTTCCAAGTTTAGGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177420.1-775s1c1
Sequence:CCGGCCATCAGTCCTTGACTACAAACTCGAGTTTGTAGTCAAGGACTGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177420.1-156s1c1
Sequence:CCGGACACTCGGTATTGTTGGAGATCTCGAGATCTCCAACAATACCGAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177420.1-775s21c1
Sequence:CCGGCCATCAGTCCTTGACTACAAACTCGAGTTTGTAGTCAAGGACTGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177420.1-1695s1c1
Sequence:CCGGGCTGTGTTTATGTAGTGGGTACTCGAGTACCCACTACATAAACACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177420.1-156s21c1
Sequence:CCGGACACTCGGTATTGTTGGAGATCTCGAGATCTCCAACAATACCGAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177420.1-1695s21c1
Sequence:CCGGGCTGTGTTTATGTAGTGGGTACTCGAGTACCCACTACATAAACACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)