EMAIL THIS PAGE TO A FRIEND

PSCA

prostate stem cell antigen

36 Gene Product Result for
Synonyms: PRO232
UniProtKB ID: O43653, Q6UW92
Gene ID:
Human(8000) Summary: This gene encodes a glycosylphosphatidylinositol-anchored cell membrane glycoprotein. In addition to being highly expressed in the prostate it is also expressed in the bladder, placenta, colon, kidney, and stomach. This gene is up-regulated in a large proportion of prostate cancers and is also detected in cancers of the bladder and pancreas. This gene includes a polymorphism that results in an upstream start codon in some individuals; this polymorphism is thought to be associated with a risk for certain gastric and bladder cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Mouse(72373) prostate stem cell antigen
Rat(680210) prostate stem cell antigen
chicken(420302) prostate stem cell antigen
dog(482068) prostate stem cell antigen
domestic cat(101097300) prostate stem cell antigen
domestic guinea pig(100723472) prostate stem cell antigen
naked mole-rat(101705338) prostate stem cell antigen
cow(100298702) prostate stem cell antigen
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005672 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005672 Rosetta Predictions human pricing
NM_028216 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061701 predicted 617
2 SASI_Hs01_00061702 predicted 540
3 SASI_Hs02_00340059 predicted 615
4 SASI_Hs02_00340060 predicted 530
5 SASI_Hs01_00061706 predicted 292
6 SASI_Hs01_00061707 predicted 307
7 SASI_Hs01_00061708 predicted 524
8 SASI_Hs01_00061709 predicted 705
9 SASI_Hs02_00340061 predicted 514
10 SASI_Hs02_00340062 predicted 265
11 SASI_Hs01_00061703 predicted 228
12 SASI_Hs01_00061704 predicted 214
13 SASI_Hs01_00061705 predicted 282
14 SASI_Hs01_00061710 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054168 predicted 199
2 SASI_Mm01_00054169 predicted 108
3 SASI_Mm01_00054170 predicted 589
4 SASI_Mm01_00054171 predicted 270
5 SASI_Mm01_00054172 predicted 106
6 SASI_Mm01_00054173 predicted 543
7 SASI_Mm01_00054174 predicted 696
8 SASI_Mm01_00054175 predicted 790
9 SASI_Mm01_00054176 predicted 795
10 SASI_Mm01_00054177 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028216
PSCA MISSION shRNA Bacterial Glycerol Stock
prostate stem cell antigen
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028216.1-69s21c1
Sequence:CCGGGTGCTGCTCTGCAGTGCTATTCTCGAGAATAGCACTGCAGAGCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028216.1-473s1c1
Sequence:CCGGCACCACTCTTAACTCCCACATCTCGAGATGTGGGAGTTAAGAGTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028216.1-154s1c1
Sequence:CCGGCAGTTGCTTTACATCGCGCATCTCGAGATGCGCGATGTAAAGCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028216.1-144s21c1
Sequence:CCGGTGGACCAGCACAGTTGCTTTACTCGAGTAAAGCAACTGTGCTGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028216.1-231s21c1
Sequence:CCGGATGACTCGGAGAACTACTATTCTCGAGAATAGTAGTTCTCCGAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028216.1-537s21c1
Sequence:CCGGTCTCCTCTCTGCTGCTATTTCCTCGAGGAAATAGCAGCAGAGAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028216.1-181s21c1
Sequence:CCGGCATTGGACTCGTGACAGTTATCTCGAGATAACTGTCACGAGTCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028216.1-186s1c1
Sequence:CCGGGACTCGTGACAGTTATCAGTACTCGAGTACTGATAACTGTCACGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028216
PSCA MISSION shRNA shRNA Plasmid DNA
prostate stem cell antigen
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028216.1-69s21c1
Sequence:CCGGGTGCTGCTCTGCAGTGCTATTCTCGAGAATAGCACTGCAGAGCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028216.1-473s1c1
Sequence:CCGGCACCACTCTTAACTCCCACATCTCGAGATGTGGGAGTTAAGAGTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028216.1-154s1c1
Sequence:CCGGCAGTTGCTTTACATCGCGCATCTCGAGATGCGCGATGTAAAGCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028216.1-144s21c1
Sequence:CCGGTGGACCAGCACAGTTGCTTTACTCGAGTAAAGCAACTGTGCTGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028216.1-231s21c1
Sequence:CCGGATGACTCGGAGAACTACTATTCTCGAGAATAGTAGTTCTCCGAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028216.1-537s21c1
Sequence:CCGGTCTCCTCTCTGCTGCTATTTCCTCGAGGAAATAGCAGCAGAGAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028216.1-181s21c1
Sequence:CCGGCATTGGACTCGTGACAGTTATCTCGAGATAACTGTCACGAGTCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028216.1-186s1c1
Sequence:CCGGGACTCGTGACAGTTATCAGTACTCGAGTACTGATAACTGTCACGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028216
PSCA MISSION shRNA Lentiviral Transduction Particles
prostate stem cell antigen
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028216.1-69s21c1
Sequence:CCGGGTGCTGCTCTGCAGTGCTATTCTCGAGAATAGCACTGCAGAGCAGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028216.1-473s1c1
Sequence:CCGGCACCACTCTTAACTCCCACATCTCGAGATGTGGGAGTTAAGAGTGGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028216.1-154s1c1
Sequence:CCGGCAGTTGCTTTACATCGCGCATCTCGAGATGCGCGATGTAAAGCAACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028216.1-144s21c1
Sequence:CCGGTGGACCAGCACAGTTGCTTTACTCGAGTAAAGCAACTGTGCTGGTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028216.1-231s21c1
Sequence:CCGGATGACTCGGAGAACTACTATTCTCGAGAATAGTAGTTCTCCGAGTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028216.1-537s21c1
Sequence:CCGGTCTCCTCTCTGCTGCTATTTCCTCGAGGAAATAGCAGCAGAGAGGAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028216.1-181s21c1
Sequence:CCGGCATTGGACTCGTGACAGTTATCTCGAGATAACTGTCACGAGTCCAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028216.1-186s1c1
Sequence:CCGGGACTCGTGACAGTTATCAGTACTCGAGTACTGATAACTGTCACGAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005672
PSCA MISSION shRNA Bacterial Glycerol Stock
prostate stem cell antigen
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005672.3-314s21c1
Sequence:CCGGTGTGACACCGACTTGTGCAACCTCGAGGTTGCACAAGTCGGTGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005672.3-541s21c1
Sequence:CCGGACGCAAGTCTGACCATGTATGCTCGAGCATACATGGTCAGACTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005672.3-117s21c1
Sequence:CCGGTGCTGTGCTACTCCTGCAAAGCTCGAGCTTTGCAGGAGTAGCACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005672.3-269s21c1
Sequence:CCGGGATGACTCACAGGACTACTACCTCGAGGTAGTAGTCCTGTGAGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005672.3-292s21c1
Sequence:CCGGGGGCAAGAAGAACATCACGTGCTCGAGCACGTGATGTTCTTCTTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005672
PSCA MISSION shRNA shRNA Plasmid DNA
prostate stem cell antigen
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005672.3-314s21c1
Sequence:CCGGTGTGACACCGACTTGTGCAACCTCGAGGTTGCACAAGTCGGTGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005672.3-541s21c1
Sequence:CCGGACGCAAGTCTGACCATGTATGCTCGAGCATACATGGTCAGACTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005672.3-117s21c1
Sequence:CCGGTGCTGTGCTACTCCTGCAAAGCTCGAGCTTTGCAGGAGTAGCACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005672.3-269s21c1
Sequence:CCGGGATGACTCACAGGACTACTACCTCGAGGTAGTAGTCCTGTGAGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005672.3-292s21c1
Sequence:CCGGGGGCAAGAAGAACATCACGTGCTCGAGCACGTGATGTTCTTCTTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005672
PSCA MISSION shRNA Lentiviral Transduction Particles
prostate stem cell antigen
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005672.3-314s21c1
Sequence:CCGGTGTGACACCGACTTGTGCAACCTCGAGGTTGCACAAGTCGGTGTCACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005672.3-541s21c1
Sequence:CCGGACGCAAGTCTGACCATGTATGCTCGAGCATACATGGTCAGACTTGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005672.3-117s21c1
Sequence:CCGGTGCTGTGCTACTCCTGCAAAGCTCGAGCTTTGCAGGAGTAGCACAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005672.3-269s21c1
Sequence:CCGGGATGACTCACAGGACTACTACCTCGAGGTAGTAGTCCTGTGAGTCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005672.3-292s21c1
Sequence:CCGGGGGCAAGAAGAACATCACGTGCTCGAGCACGTGATGTTCTTCTTGCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)