EMAIL THIS PAGE TO A FRIEND

PSD4

pleckstrin and Sec7 domain containing 4

56 Gene Product Result for
Synonyms: EFA6B TIC
Gene ID:
Mouse(215632) pleckstrin and Sec7 domain containing 4
Rat(311785) pleckstrin and Sec7 domain containing 4
Horse(100065242) pleckstrin and Sec7 domain containing 4
dog(483069) pleckstrin and Sec7 domain containing 4
domestic cat(101080883) pleckstrin and Sec7 domain containing 4
domestic guinea pig(100734136) pleckstrin and Sec7 domain containing 4
Domestic Rabbit(100355765) pleckstrin and Sec7 domain containing 4
naked mole-rat(101706961) pleckstrin and Sec7 domain containing 4
cow(532237) pleckstrin and Sec7 domain containing 4
sheep(101105738) pleckstrin and Sec7 domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012455 Rosetta Predictions human pricing
NM_001134881 Rosetta Predictions rat pricing
XM_001071370 Rosetta Predictions rat pricing
NM_177611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056983 predicted 1820
2 SASI_Hs01_00056984 predicted 2588
3 SASI_Hs01_00056985 predicted 1910
4 SASI_Hs01_00056986 predicted 2735
5 SASI_Hs01_00056987 predicted 3298
6 SASI_Hs01_00056988 predicted 1595
7 SASI_Hs01_00056989 predicted 1906
8 SASI_Hs01_00056990 predicted 1632
9 SASI_Hs01_00056991 predicted 1917
10 SASI_Hs01_00056992 predicted 2235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258934 predicted 1774
2 SASI_Rn02_00258935 predicted 3301
3 SASI_Rn02_00258936 predicted 2486
4 SASI_Rn02_00258937 predicted 2787
5 SASI_Rn02_00258938 predicted 2046
6 SASI_Rn02_00258939 predicted 2387
7 SASI_Rn02_00258940 predicted 530
8 SASI_Rn02_00258941 predicted 3424
9 SASI_Rn02_00258942 predicted 2090
10 SASI_Rn02_00258943 predicted 3521
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334855 predicted 1771
2 SASI_Rn02_00334856 predicted 3302
3 SASI_Rn02_00334857 predicted 2490
4 SASI_Rn02_00334858 predicted 2791
5 SASI_Rn02_00334859 predicted 2046
6 SASI_Rn02_00334860 predicted 2386
7 SASI_Rn02_00334861 predicted 529
8 SASI_Rn02_00334862 predicted 3428
9 SASI_Rn02_00334863 predicted 2090
10 SASI_Rn02_00334864 predicted 3518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136512 predicted 606
2 SASI_Mm01_00136513 predicted 2130
3 SASI_Mm01_00136515 predicted 1796
4 SASI_Mm01_00136516 predicted 2202
5 SASI_Mm01_00136517 predicted 2496
6 SASI_Mm01_00136518 predicted 841
7 SASI_Mm01_00136519 predicted 1176
8 SASI_Mm01_00136520 predicted 3237
9 SASI_Mm01_00136521 predicted 2905
10 SASI_Mm02_00347840 predicted 2424
11 SASI_Mm01_00136514 predicted 3144
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012455
PSD4 MISSION shRNA Bacterial Glycerol Stock
pleckstrin and Sec7 domain containing 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012455.2-1141s21c1
Sequence:CCGGTTCCCTGTGCCCATCTATAAACTCGAGTTTATAGATGGGCACAGGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012455.2-3412s21c1
Sequence:CCGGTCCCTGGAGGAGACTTATTTCCTCGAGGAAATAAGTCTCCTCCAGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012455.2-1903s21c1
Sequence:CCAGGCTGGAGACAAGCTAGCTAATCTCGAGATTAGCTAGCTTGTCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012455.2-2012s21c1
Sequence:CCGGTGCAGAAGAACAATGACTTTACTCGAGTAAAGTCATTGTTCTTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012455.2-3666s21c1
Sequence:CCGGGAATCCAGAGTGGCCTCATTTCTCGAGAAATGAGGCCACTCTGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012455.1-349s1c1
Sequence:CCGGCCTCCTGAATCTACCAGACAACTCGAGTTGTCTGGTAGATTCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012455.1-1558s1c1
Sequence:CCGGCAGCCAAGTTCCTTGAAGAAACTCGAGTTTCTTCAAGGAACTTGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012455.1-2106s1c1
Sequence:CCGGCACCTTGACATGTGCAATCATCTCGAGATGATTGCACATGTCAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012455
PSD4 MISSION shRNA shRNA Plasmid DNA
pleckstrin and Sec7 domain containing 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012455.2-1141s21c1
Sequence:CCGGTTCCCTGTGCCCATCTATAAACTCGAGTTTATAGATGGGCACAGGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012455.2-3412s21c1
Sequence:CCGGTCCCTGGAGGAGACTTATTTCCTCGAGGAAATAAGTCTCCTCCAGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012455.2-1903s21c1
Sequence:CCAGGCTGGAGACAAGCTAGCTAATCTCGAGATTAGCTAGCTTGTCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012455.2-2012s21c1
Sequence:CCGGTGCAGAAGAACAATGACTTTACTCGAGTAAAGTCATTGTTCTTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012455.2-3666s21c1
Sequence:CCGGGAATCCAGAGTGGCCTCATTTCTCGAGAAATGAGGCCACTCTGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012455.1-349s1c1
Sequence:CCGGCCTCCTGAATCTACCAGACAACTCGAGTTGTCTGGTAGATTCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012455.1-1558s1c1
Sequence:CCGGCAGCCAAGTTCCTTGAAGAAACTCGAGTTTCTTCAAGGAACTTGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012455.1-2106s1c1
Sequence:CCGGCACCTTGACATGTGCAATCATCTCGAGATGATTGCACATGTCAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012455
PSD4 MISSION shRNA Lentiviral Transduction Particles
pleckstrin and Sec7 domain containing 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012455.2-1141s21c1
Sequence:CCGGTTCCCTGTGCCCATCTATAAACTCGAGTTTATAGATGGGCACAGGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012455.2-3412s21c1
Sequence:CCGGTCCCTGGAGGAGACTTATTTCCTCGAGGAAATAAGTCTCCTCCAGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012455.2-1903s21c1
Sequence:CCAGGCTGGAGACAAGCTAGCTAATCTCGAGATTAGCTAGCTTGTCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012455.2-2012s21c1
Sequence:CCGGTGCAGAAGAACAATGACTTTACTCGAGTAAAGTCATTGTTCTTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012455.2-3666s21c1
Sequence:CCGGGAATCCAGAGTGGCCTCATTTCTCGAGAAATGAGGCCACTCTGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012455.1-349s1c1
Sequence:CCGGCCTCCTGAATCTACCAGACAACTCGAGTTGTCTGGTAGATTCAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012455.1-1558s1c1
Sequence:CCGGCAGCCAAGTTCCTTGAAGAAACTCGAGTTTCTTCAAGGAACTTGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012455.1-2106s1c1
Sequence:CCGGCACCTTGACATGTGCAATCATCTCGAGATGATTGCACATGTCAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177611
PSD4 MISSION shRNA Bacterial Glycerol Stock
pleckstrin and Sec7 domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177611.3-3332s1c1
Sequence:CCGGGCTCTTTAGAACTGCCTTAATCTCGAGATTAAGGCAGTTCTAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177611.3-2071s1c1
Sequence:CCGGCCTGTGCAATCATGCTCCTTACTCGAGTAAGGAGCATGATTGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177611.3-1847s1c1
Sequence:CCGGCCTACGCAAGAACAATGACTTCTCGAGAAGTCATTGTTCTTGCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177611.3-2370s1c1
Sequence:CCGGGCTCGGAAGATGCATCACATTCTCGAGAATGTGATGCATCTTCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177611.3-1125s1c1
Sequence:CCGGGCACCCTTTGTAGACCATGAACTCGAGTTCATGGTCTACAAAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177611
PSD4 MISSION shRNA shRNA Plasmid DNA
pleckstrin and Sec7 domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177611.3-3332s1c1
Sequence:CCGGGCTCTTTAGAACTGCCTTAATCTCGAGATTAAGGCAGTTCTAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177611.3-2071s1c1
Sequence:CCGGCCTGTGCAATCATGCTCCTTACTCGAGTAAGGAGCATGATTGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177611.3-1847s1c1
Sequence:CCGGCCTACGCAAGAACAATGACTTCTCGAGAAGTCATTGTTCTTGCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177611.3-2370s1c1
Sequence:CCGGGCTCGGAAGATGCATCACATTCTCGAGAATGTGATGCATCTTCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177611.3-1125s1c1
Sequence:CCGGGCACCCTTTGTAGACCATGAACTCGAGTTCATGGTCTACAAAGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177611
PSD4 MISSION shRNA Lentiviral Transduction Particles
pleckstrin and Sec7 domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177611.3-3332s1c1
Sequence:CCGGGCTCTTTAGAACTGCCTTAATCTCGAGATTAAGGCAGTTCTAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177611.3-2071s1c1
Sequence:CCGGCCTGTGCAATCATGCTCCTTACTCGAGTAAGGAGCATGATTGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177611.3-1847s1c1
Sequence:CCGGCCTACGCAAGAACAATGACTTCTCGAGAAGTCATTGTTCTTGCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177611.3-2370s1c1
Sequence:CCGGGCTCGGAAGATGCATCACATTCTCGAGAATGTGATGCATCTTCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177611.3-1125s1c1
Sequence:CCGGGCACCCTTTGTAGACCATGAACTCGAGTTCATGGTCTACAAAGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)