EMAIL THIS PAGE TO A FRIEND

PSD

pleckstrin and Sec7 domain containing

108 Gene Product Result for
Synonyms: EFA6 EFA6A PSD1 TYL
UniProtKB ID: A5PKW4, B1AKX7, D3DR87, Q15673, Q8IVG0
Gene ID:
Human(5662) Summary: This gene encodes a Plekstrin homology and SEC7 domains-containing protein that functions as a guanine nucleotide exchange factor. The encoded protein regulates signal transduction by activating ADP-ribosylation factor 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(73728) pleckstrin and Sec7 domain containing
Rat(171381) pleckstrin and Sec7 domain containing
cow(523124) pleckstrin and Sec7 domain containing
sheep(101107649) pleckstrin and Sec7 domain containing
naked mole-rat(101717970) pleckstrin and Sec7 domain containing
domestic guinea pig(100714968) pleckstrin and Sec7 domain containing
fruit fly(33830) palisade
Thale Cress(843588) exportin-T
domestic cat(101080830) pleckstrin and Sec7 domain containing
dog(486859) pleckstrin and Sec7 domain containing
chicken(423760) pleckstrin and Sec7 domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002779 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002779 Rosetta Predictions human pricing
XM_001066704 Rosetta Predictions rat pricing
XM_001066749 Rosetta Predictions rat pricing
XM_001070097 Rosetta Predictions rat pricing
XM_001070141 Rosetta Predictions rat pricing
NM_028627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228265 predicted 2615
2 SASI_Hs01_00228266 predicted 3472
3 SASI_Hs01_00228267 predicted 3087
4 SASI_Hs01_00228268 predicted 2423
5 SASI_Hs01_00228269 predicted 2574
6 SASI_Hs01_00228270 predicted 2502
7 SASI_Hs01_00228271 predicted 3395
8 SASI_Hs01_00228272 predicted 3020
9 SASI_Hs02_00334418 predicted 3027
10 SASI_Hs02_00334419 predicted 844
11 SASI_Hs01_00228264 predicted 2675
12 SASI_Hs01_00228273 predicted 2353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318493 predicted 2006
2 SASI_Rn02_00318494 predicted 1525
3 SASI_Rn02_00318495 predicted 1874
4 SASI_Rn02_00318496 predicted 634
5 SASI_Rn02_00318497 predicted 2015
6 SASI_Rn02_00318498 predicted 1336
7 SASI_Rn02_00318499 predicted 1433
8 SASI_Rn02_00318500 predicted 1580
9 SASI_Rn02_00318501 predicted 643
10 SASI_Rn02_00318502 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318612 predicted 901
2 SASI_Rn02_00318613 predicted 653
3 SASI_Rn02_00318614 predicted 2766
4 SASI_Rn02_00318615 predicted 2291
5 SASI_Rn02_00318616 predicted 2638
6 SASI_Rn02_00318617 predicted 1396
7 SASI_Rn02_00318618 predicted 2781
8 SASI_Rn02_00318619 predicted 2105
9 SASI_Rn02_00318620 predicted 2203
10 SASI_Rn02_00318621 predicted 2341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330450 predicted 879
2 SASI_Rn02_00330451 predicted 738
3 SASI_Rn02_00330452 predicted 631
4 SASI_Rn02_00330453 predicted 566
5 SASI_Rn02_00330454 predicted 861
6 SASI_Rn02_00330455 predicted 477
7 SASI_Rn02_00330456 predicted 639
8 SASI_Rn02_00330457 predicted 883
9 SASI_Rn02_00330458 predicted 831
10 SASI_Rn02_00330459 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330576 predicted 1503
2 SASI_Rn02_00330577 predicted 1393
3 SASI_Rn02_00330578 predicted 1333
4 SASI_Rn02_00330579 predicted 1619
5 SASI_Rn02_00330580 predicted 1133
6 SASI_Rn02_00330581 predicted 1245
7 SASI_Rn02_00330582 predicted 1407
8 SASI_Rn02_00330583 predicted 1651
9 SASI_Rn02_00330584 predicted 1600
10 SASI_Rn02_00330585 predicted 1630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122320 predicted 903
2 SASI_Mm01_00122322 predicted 2303
3 SASI_Mm01_00122323 predicted 2114
4 SASI_Mm01_00122324 predicted 2983
5 SASI_Mm01_00122326 predicted 1865
6 SASI_Mm02_00334142 predicted 1250
7 SASI_Mm01_00122327 predicted 1051
8 SASI_Mm01_00122328 predicted 1965
9 SASI_Mm01_00122329 predicted 1414
10 SASI_Mm02_00334143 predicted 1414
11 SASI_Mm01_00122321 predicted 2617
12 SASI_Mm01_00122325 predicted 2586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002779
PSD MISSION shRNA Bacterial Glycerol Stock
pleckstrin and Sec7 domain containing
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002779.2-2299s1c1
Sequence:CCGGGCATCAATGTAGTAGCCGCTACTCGAGTAGCGGCTACTACATTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002779.2-2303s1c1
Sequence:CCGGCAATGTAGTAGCCGCTATGTTCTCGAGAACATAGCGGCTACTACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002779.3-1073s21c1
Sequence:CCGGGGTTGGAGCAGATGGCCTTTACTCGAGTAAAGGCCATCTGCTCCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002779.3-1226s21c1
Sequence:CCGGGAGAATCGCTAGAGCCAAATGCTCGAGCATTTGGCTCTAGCGATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002779.3-3103s21c1
Sequence:CCGGCCTGGATCACTCGCATCAATGCTCGAGCATTGATGCGAGTGATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002779.3-3974s21c1
Sequence:CCGGGCTTGGACAGAGACCAGGATTCTCGAGAATCCTGGTCTCTGTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002779.3-2302s21c1
Sequence:CCGGGGGAGTACCTCAAGTTCTTTGCTCGAGCAAAGAACTTGAGGTACTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002779
PSD MISSION shRNA shRNA Plasmid DNA
pleckstrin and Sec7 domain containing
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002779.2-2299s1c1
Sequence:CCGGGCATCAATGTAGTAGCCGCTACTCGAGTAGCGGCTACTACATTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002779.2-2303s1c1
Sequence:CCGGCAATGTAGTAGCCGCTATGTTCTCGAGAACATAGCGGCTACTACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002779.3-1073s21c1
Sequence:CCGGGGTTGGAGCAGATGGCCTTTACTCGAGTAAAGGCCATCTGCTCCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002779.3-1226s21c1
Sequence:CCGGGAGAATCGCTAGAGCCAAATGCTCGAGCATTTGGCTCTAGCGATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002779.3-3103s21c1
Sequence:CCGGCCTGGATCACTCGCATCAATGCTCGAGCATTGATGCGAGTGATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002779.3-3974s21c1
Sequence:CCGGGCTTGGACAGAGACCAGGATTCTCGAGAATCCTGGTCTCTGTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002779.3-2302s21c1
Sequence:CCGGGGGAGTACCTCAAGTTCTTTGCTCGAGCAAAGAACTTGAGGTACTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002779
PSD MISSION shRNA Lentiviral Transduction Particles
pleckstrin and Sec7 domain containing
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002779.2-2299s1c1
Sequence:CCGGGCATCAATGTAGTAGCCGCTACTCGAGTAGCGGCTACTACATTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002779.2-2303s1c1
Sequence:CCGGCAATGTAGTAGCCGCTATGTTCTCGAGAACATAGCGGCTACTACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002779.3-1073s21c1
Sequence:CCGGGGTTGGAGCAGATGGCCTTTACTCGAGTAAAGGCCATCTGCTCCAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002779.3-1226s21c1
Sequence:CCGGGAGAATCGCTAGAGCCAAATGCTCGAGCATTTGGCTCTAGCGATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002779.3-3103s21c1
Sequence:CCGGCCTGGATCACTCGCATCAATGCTCGAGCATTGATGCGAGTGATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002779.3-3974s21c1
Sequence:CCGGGCTTGGACAGAGACCAGGATTCTCGAGAATCCTGGTCTCTGTCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002779.3-2302s21c1
Sequence:CCGGGGGAGTACCTCAAGTTCTTTGCTCGAGCAAAGAACTTGAGGTACTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028627
PSD MISSION shRNA Bacterial Glycerol Stock
pleckstrin and Sec7 domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028627.2-3568s1c1
Sequence:CCGGCCTTTCCTTTCCTTCTTTCTTCTCGAGAAGAAAGAAGGAAAGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028627.2-1984s1c1
Sequence:CCGGGCTGGCGAGTATCTGAAGTTTCTCGAGAAACTTCAGATACTCGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028627.2-2112s1c1
Sequence:CCGGCCAGCGATATTTCCAGTGTAACTCGAGTTACACTGGAAATATCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028627.2-2211s1c1
Sequence:CCGGCCATAACATTGGGAAGCGCATCTCGAGATGCGCTTCCCAATGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028627.2-1411s1c1
Sequence:CCGGGACTCCTTCAGTTGTGTGTTTCTCGAGAAACACACAACTGAAGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028627
PSD MISSION shRNA shRNA Plasmid DNA
pleckstrin and Sec7 domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028627.2-3568s1c1
Sequence:CCGGCCTTTCCTTTCCTTCTTTCTTCTCGAGAAGAAAGAAGGAAAGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028627.2-1984s1c1
Sequence:CCGGGCTGGCGAGTATCTGAAGTTTCTCGAGAAACTTCAGATACTCGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028627.2-2112s1c1
Sequence:CCGGCCAGCGATATTTCCAGTGTAACTCGAGTTACACTGGAAATATCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028627.2-2211s1c1
Sequence:CCGGCCATAACATTGGGAAGCGCATCTCGAGATGCGCTTCCCAATGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028627.2-1411s1c1
Sequence:CCGGGACTCCTTCAGTTGTGTGTTTCTCGAGAAACACACAACTGAAGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028627
PSD MISSION shRNA Lentiviral Transduction Particles
pleckstrin and Sec7 domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028627.2-3568s1c1
Sequence:CCGGCCTTTCCTTTCCTTCTTTCTTCTCGAGAAGAAAGAAGGAAAGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028627.2-1984s1c1
Sequence:CCGGGCTGGCGAGTATCTGAAGTTTCTCGAGAAACTTCAGATACTCGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028627.2-2112s1c1
Sequence:CCGGCCAGCGATATTTCCAGTGTAACTCGAGTTACACTGGAAATATCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028627.2-2211s1c1
Sequence:CCGGCCATAACATTGGGAAGCGCATCTCGAGATGCGCTTCCCAATGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028627.2-1411s1c1
Sequence:CCGGGACTCCTTCAGTTGTGTGTTTCTCGAGAAACACACAACTGAAGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)