EMAIL THIS PAGE TO A FRIEND

PSEN1

presenilin 1

100 Gene Product Result for
Synonyms: AD3 FAD PS-1 PS1 S182
Gene ID:
Human(5663) Summary: Alzheimer's disease (AD) patients with an inherited form of the disease carry mutations in the presenilin proteins (PSEN1; PSEN2) or in the amyloid precursor protein (APP). These disease-linked mutations result in increased production of the longer form of amyloid-beta (main component of amyloid deposits found in AD brains). Presenilins are postulated to regulate APP processing through their effects on gamma-secretase, an enzyme that cleaves APP. Also, it is thought that the presenilins are involved in the cleavage of the Notch receptor, such that they either directly regulate gamma-secretase activity or themselves are protease enzymes. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene, the full-length nature of only some have been determined. [provided by RefSeq, Aug 2008]
Mouse(19164) presenilin 1
Rat(29192) presenilin 1
cow(282705) presenilin 1
sheep(101102488) presenilin 1
Zebrafish(30221) presenilin 1
dog(403408) presenilin 1
chicken(373977) presenilin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504724 Anti-phospho-PSEN1 (pSer357) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502424 Anti-Presenilin 1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
P5235 Anti-Presenilin-1 (14-33) antibody produced in goat whole antiserum human
immunohistochemistry pricing
P5110 Anti-Presenilin-1 (303-316) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse
immunofluorescence, western blot pricing
P7854 Anti-Presenilin-1 (S182) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, rat, human, Xenopus
immunohistochemistry, microarray, western blot pricing
PRS4203 Anti-Presenilin1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA030760 Anti-PSEN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4502423 Anti-PSEN1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
HPA067496 Anti-PSEN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D5942 DAPT ≥98% (HPLC), solid human, mouse, rat pricing
L1790 L-685,458 >96% (HPLC), solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000021 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000021 siRNAs that have been validated in the lab human pricing
NM_019163 Rosetta Predictions rat pricing
NM_008943 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000021 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043630 validated 1163
1 SASI_Hs01_00043632 validated 1071
2 SASI_Hs02_00301682 predicted 1659
3 SASI_Hs01_00043631 predicted 908
4 SASI_Hs01_00043634 predicted 889
5 SASI_Hs01_00043635 predicted 310
6 SASI_Hs01_00043636 predicted 541
7 SASI_Hs01_00043637 predicted 1620
8 SASI_Hs01_00043638 predicted 1343
9 SASI_Hs01_00043639 predicted 1473
10 SASI_Hs02_00301683 predicted 390
11 SASI_Hs01_00043633 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098768 predicted 994
2 SASI_Rn02_00261947 predicted 743
3 SASI_Rn02_00261948 predicted 490
4 SASI_Rn01_00098769 predicted 851
5 SASI_Rn02_00261949 predicted 794
6 SASI_Rn01_00098773 predicted 733
7 SASI_Rn01_00098774 predicted 560
8 SASI_Rn01_00098775 predicted 292
9 SASI_Rn01_00098776 predicted 718
10 SASI_Rn01_00098777 predicted 804
11 SASI_Rn01_00098770 predicted 1038
12 SASI_Rn01_00098771 predicted 1037
13 SASI_Rn01_00098772 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048853 predicted 977
2 SASI_Mm01_00048855 predicted 1302
3 SASI_Mm01_00048857 predicted 1072
4 SASI_Mm01_00048858 predicted 1228
5 SASI_Mm02_00314992 predicted 1328
6 SASI_Mm01_00048859 predicted 1243
7 SASI_Mm01_00048860 predicted 1437
8 SASI_Mm02_00314993 predicted 612
9 SASI_Mm01_00048861 predicted 1039
10 SASI_Mm01_00048862 predicted 888
11 SASI_Mm01_00048854 predicted 1217
12 SASI_Mm01_00048856 predicted 1331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008943
VALIDATED
PSEN1 MISSION shRNA Bacterial Glycerol Stock
presenilin 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008943.2-699s21c1
Sequence:CCGGGACGAAGAGCTGACATTGAAACTCGAGTTTCAATGTCAGCTCTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-728s1c1
Sequence:CCGGCAAGCATGTCATCATGCTCTTCTCGAGAAGAGCATGATGACATGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008943.1-1865s1c1
Sequence:CCGGCCAACTTGCATTCCATCAGTTCTCGAGAACTGATGGAATGCAAGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-699s1c1
Sequence:CCGGGACGAAGAGCTGACATTGAAACTCGAGTTTCAATGTCAGCTCTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1076s1c1
Sequence:CCGGCGTTACAGTAGCACTCCTAATCTCGAGATTAGGAGTGCTACTGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1574s1c1
Sequence:CCGGCCAGGAACTTTCTGGGAGCATCTCGAGATGCTCCCAGAAAGTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008943.1-1290s1c1
Sequence:CCGGCCACTTCGTATGCTGGTTGAACTCGAGTTCAACCAGCATACGAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008943.1-947s1c1
Sequence:CCGGCCTGTATAAATACAGGTGCTACTCGAGTAGCACCTGTATTTATACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1157s1c1
Sequence:CCGGGCAGGCGTATCTCATTATGATCTCGAGATCATAATGAGATACGCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1242s1c1
Sequence:CCGGGCTGTGATTTCAGTATATGATCTCGAGATCATATACTGAAATCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1742s1c1
Sequence:CCGGCCTGTGCCTTACATTACTCCTCTCGAGAGGAGTAATGTAAGGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008943.2-1242s21c1
Sequence:CCGGGCTGTGATTTCAGTATATGATCTCGAGATCATATACTGAAATCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008943.2-1574s21c1
Sequence:CCGGCCAGGAACTTTCTGGGAGCATCTCGAGATGCTCCCAGAAAGTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008943.2-1076s21c1
Sequence:CCGGCGTTACAGTAGCACTCCTAATCTCGAGATTAGGAGTGCTACTGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008943
VALIDATED
PSEN1 MISSION shRNA shRNA Plasmid DNA
presenilin 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008943.2-699s21c1
Sequence:CCGGGACGAAGAGCTGACATTGAAACTCGAGTTTCAATGTCAGCTCTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-728s1c1
Sequence:CCGGCAAGCATGTCATCATGCTCTTCTCGAGAAGAGCATGATGACATGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008943.1-1865s1c1
Sequence:CCGGCCAACTTGCATTCCATCAGTTCTCGAGAACTGATGGAATGCAAGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-699s1c1
Sequence:CCGGGACGAAGAGCTGACATTGAAACTCGAGTTTCAATGTCAGCTCTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1076s1c1
Sequence:CCGGCGTTACAGTAGCACTCCTAATCTCGAGATTAGGAGTGCTACTGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1574s1c1
Sequence:CCGGCCAGGAACTTTCTGGGAGCATCTCGAGATGCTCCCAGAAAGTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008943.1-1290s1c1
Sequence:CCGGCCACTTCGTATGCTGGTTGAACTCGAGTTCAACCAGCATACGAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008943.1-947s1c1
Sequence:CCGGCCTGTATAAATACAGGTGCTACTCGAGTAGCACCTGTATTTATACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1157s1c1
Sequence:CCGGGCAGGCGTATCTCATTATGATCTCGAGATCATAATGAGATACGCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1242s1c1
Sequence:CCGGGCTGTGATTTCAGTATATGATCTCGAGATCATATACTGAAATCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1742s1c1
Sequence:CCGGCCTGTGCCTTACATTACTCCTCTCGAGAGGAGTAATGTAAGGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008943.2-1242s21c1
Sequence:CCGGGCTGTGATTTCAGTATATGATCTCGAGATCATATACTGAAATCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008943.2-1574s21c1
Sequence:CCGGCCAGGAACTTTCTGGGAGCATCTCGAGATGCTCCCAGAAAGTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008943.2-1076s21c1
Sequence:CCGGCGTTACAGTAGCACTCCTAATCTCGAGATTAGGAGTGCTACTGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008943
VALIDATED
PSEN1 MISSION shRNA Lentiviral Transduction Particles
presenilin 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008943.2-699s21c1
Sequence:CCGGGACGAAGAGCTGACATTGAAACTCGAGTTTCAATGTCAGCTCTTCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-728s1c1
Sequence:CCGGCAAGCATGTCATCATGCTCTTCTCGAGAAGAGCATGATGACATGCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008943.1-1865s1c1
Sequence:CCGGCCAACTTGCATTCCATCAGTTCTCGAGAACTGATGGAATGCAAGTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-699s1c1
Sequence:CCGGGACGAAGAGCTGACATTGAAACTCGAGTTTCAATGTCAGCTCTTCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1076s1c1
Sequence:CCGGCGTTACAGTAGCACTCCTAATCTCGAGATTAGGAGTGCTACTGTAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1574s1c1
Sequence:CCGGCCAGGAACTTTCTGGGAGCATCTCGAGATGCTCCCAGAAAGTTCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008943.1-1290s1c1
Sequence:CCGGCCACTTCGTATGCTGGTTGAACTCGAGTTCAACCAGCATACGAAGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008943.1-947s1c1
Sequence:CCGGCCTGTATAAATACAGGTGCTACTCGAGTAGCACCTGTATTTATACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1157s1c1
Sequence:CCGGGCAGGCGTATCTCATTATGATCTCGAGATCATAATGAGATACGCCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1242s1c1
Sequence:CCGGGCTGTGATTTCAGTATATGATCTCGAGATCATATACTGAAATCACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008943.1-1742s1c1
Sequence:CCGGCCTGTGCCTTACATTACTCCTCTCGAGAGGAGTAATGTAAGGCACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008943.2-1242s21c1
Sequence:CCGGGCTGTGATTTCAGTATATGATCTCGAGATCATATACTGAAATCACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008943.2-1574s21c1
Sequence:CCGGCCAGGAACTTTCTGGGAGCATCTCGAGATGCTCCCAGAAAGTTCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008943.2-1076s21c1
Sequence:CCGGCGTTACAGTAGCACTCCTAATCTCGAGATTAGGAGTGCTACTGTAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000021
VALIDATED
PSEN1 MISSION shRNA Bacterial Glycerol Stock
presenilin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000021.2-1561s1c1
Sequence:CCGGCCATCACCTTTGGGCTTGTTTCTCGAGAAACAAGCCCAAAGGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000021.2-914s1c1
Sequence:CCGGGCAGGCATATCTCATTATGATCTCGAGATCATAATGAGATATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000021.2-1474s1c1
Sequence:CCGGCCTGTTTCGTAGCCATATTAACTCGAGTTAATATGGCTACGAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000021.2-1622s1c1
Sequence:CCGGCCAATTAGCATTCCATCAATTCTCGAGAATTGATGGAATGCTAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000021.2-822s1c1
Sequence:CCGGGCTGTGGACTACATTACTGTTCTCGAGAACAGTAATGTAGTCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000021.3-1658s21c1
Sequence:CCGGCCAATTAGCATTCCATCAATTCTCGAGAATTGATGGAATGCTAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000021.3-1510s21c1
Sequence:CCGGCCTGTTTCGTAGCCATATTAACTCGAGTTAATATGGCTACGAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000021.3-858s21c1
Sequence:CCGGGCTGTGGACTACATTACTGTTCTCGAGAACAGTAATGTAGTCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000021.3-1597s21c1
Sequence:CCGGCCATCACCTTTGGGCTTGTTTCTCGAGAAACAAGCCCAAAGGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000021
VALIDATED
PSEN1 MISSION shRNA shRNA Plasmid DNA
presenilin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000021.2-1561s1c1
Sequence:CCGGCCATCACCTTTGGGCTTGTTTCTCGAGAAACAAGCCCAAAGGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000021.2-914s1c1
Sequence:CCGGGCAGGCATATCTCATTATGATCTCGAGATCATAATGAGATATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000021.2-1474s1c1
Sequence:CCGGCCTGTTTCGTAGCCATATTAACTCGAGTTAATATGGCTACGAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000021.2-1622s1c1
Sequence:CCGGCCAATTAGCATTCCATCAATTCTCGAGAATTGATGGAATGCTAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000021.2-822s1c1
Sequence:CCGGGCTGTGGACTACATTACTGTTCTCGAGAACAGTAATGTAGTCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000021.3-1658s21c1
Sequence:CCGGCCAATTAGCATTCCATCAATTCTCGAGAATTGATGGAATGCTAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000021.3-1510s21c1
Sequence:CCGGCCTGTTTCGTAGCCATATTAACTCGAGTTAATATGGCTACGAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000021.3-858s21c1
Sequence:CCGGGCTGTGGACTACATTACTGTTCTCGAGAACAGTAATGTAGTCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000021.3-1597s21c1
Sequence:CCGGCCATCACCTTTGGGCTTGTTTCTCGAGAAACAAGCCCAAAGGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000021
VALIDATED
PSEN1 MISSION shRNA Lentiviral Transduction Particles
presenilin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000021.2-1561s1c1
Sequence:CCGGCCATCACCTTTGGGCTTGTTTCTCGAGAAACAAGCCCAAAGGTGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000021.2-914s1c1
Sequence:CCGGGCAGGCATATCTCATTATGATCTCGAGATCATAATGAGATATGCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000021.2-1474s1c1
Sequence:CCGGCCTGTTTCGTAGCCATATTAACTCGAGTTAATATGGCTACGAAACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000021.2-1622s1c1
Sequence:CCGGCCAATTAGCATTCCATCAATTCTCGAGAATTGATGGAATGCTAATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000021.2-822s1c1
Sequence:CCGGGCTGTGGACTACATTACTGTTCTCGAGAACAGTAATGTAGTCCACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000021.3-1658s21c1
Sequence:CCGGCCAATTAGCATTCCATCAATTCTCGAGAATTGATGGAATGCTAATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000021.3-1510s21c1
Sequence:CCGGCCTGTTTCGTAGCCATATTAACTCGAGTTAATATGGCTACGAAACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000021.3-858s21c1
Sequence:CCGGGCTGTGGACTACATTACTGTTCTCGAGAACAGTAATGTAGTCCACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000021.3-1597s21c1
Sequence:CCGGCCATCACCTTTGGGCTTGTTTCTCGAGAAACAAGCCCAAAGGTGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)