EMAIL THIS PAGE TO A FRIEND

PSEN2

presenilin 2 (Alzheimer disease 4)

91 Gene Product Result for
Synonyms: AD3L AD4 CMD1V PS2 STM2
UniProtKB ID: P49810, A8K8D4, B1AP21, Q96P32
Gene ID:
Human(5664) Summary: Alzheimer's disease (AD) patients with an inherited form of the disease carry mutations in the presenilin proteins (PSEN1 or PSEN2) or the amyloid precursor protein (APP). These disease-linked mutations result in increased production of the longer form of amyloid-beta (main component of amyloid deposits found in AD brains). Presenilins are postulated to regulate APP processing through their effects on gamma-secretase, an enzyme that cleaves APP. Also, it is thought that the presenilins are involved in the cleavage of the Notch receptor such that, they either directly regulate gamma-secretase activity, or themselves act are protease enzymes. Two alternatively spliced transcript variants encoding different isoforms of PSEN2 have been identified. [provided by RefSeq, Jul 2008]
Mouse(19165) presenilin 2
Rat(81751) presenilin 2
Zebrafish(58026) presenilin 2
dog(490382) presenilin 2 (Alzheimer disease 4)
domestic cat(101081693) presenilin 2 (Alzheimer disease 4)
chicken(374188) presenilin 2 (Alzheimer disease 4)
Domestic Rabbit(100343671) presenilin 2 (Alzheimer disease 4)
cow(282010) presenilin 2 (Alzheimer disease 4)
sheep(101113776) presenilin 2 (Alzheimer disease 4)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
P5622 Anti-Pen-2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
microarray, western blot pricing
P0070 Anti-Presenilin-2, N-terminal antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
P0607 Anti-Presenilin-2, N-terminal antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunohistochemistry, western blot pricing
AV44289 Anti-PSEN2 antibody produced in rabbit affinity isolated antibody human, zebrafish, bovine, canine, mouse, horse, pig, rabbit, guinea pig, rat,
immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D5942 DAPT ≥98% (HPLC), solid human, mouse, rat pricing
L1790 L-685,458 >96% (HPLC), solid human, mouse, rat pricing

Proteins

Product # Description Species Add to Cart
 
P2740 Presenilin-2 N-Terminal Peptide lyophilized powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000447 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011183 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011183 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011183 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000447 siRNAs that have been validated in the lab human pricing
NM_012486 Rosetta Predictions human pricing
NM_031087 Rosetta Predictions rat pricing
NM_001128605 Rosetta Predictions mouse pricing
NM_011183 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000447 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033517 validated 1687
1 SASI_Hs01_00033518 validated 737
1 SASI_Hs01_00033516 validated 850
2 SASI_Hs01_00033519 predicted 1145
3 SASI_Hs01_00033520 predicted 675
4 SASI_Hs01_00033522 predicted 661
5 SASI_Hs01_00033523 predicted 1787
6 SASI_Hs02_00302564 predicted 1935
7 SASI_Hs01_00033525 predicted 865
8 SASI_Hs02_00302565 predicted 1168
9 SASI_Hs01_00033521 predicted 1556
10 SASI_Hs01_00033524 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150765 predicted 851
2 SASI_Hs01_00150766 predicted 1674
3 SASI_Hs01_00150767 predicted 731
4 SASI_Hs01_00150768 predicted 1142
5 SASI_Hs01_00150769 predicted 673
6 SASI_Hs01_00150771 predicted 657
7 SASI_Hs01_00150772 predicted 1782
8 SASI_Hs02_00344407 predicted 1932
9 SASI_Hs01_00150774 predicted 859
10 SASI_Hs02_00344408 predicted 1167
11 SASI_Hs01_00150770 predicted 1549
12 SASI_Hs01_00150773 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118654 predicted 554
2 SASI_Rn01_00118655 predicted 671
3 SASI_Rn01_00118656 predicted 837
4 SASI_Rn01_00118657 predicted 552
5 SASI_Rn02_00264330 predicted 962
6 SASI_Rn01_00118658 predicted 619
7 SASI_Rn01_00118659 predicted 516
8 SASI_Rn01_00118660 predicted 369
9 SASI_Rn01_00118661 predicted 505
10 SASI_Rn01_00118662 predicted 441
11 SASI_Rn01_00118663 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310708 predicted 499
2 SASI_Mm02_00310709 predicted 688
3 SASI_Mm02_00310710 predicted 361
4 SASI_Mm02_00310711 predicted 947
5 SASI_Mm02_00310712 predicted 1043
6 SASI_Mm02_00310713 predicted 606
7 SASI_Mm02_00310714 predicted 532
8 SASI_Mm02_00310715 predicted 1758
9 SASI_Mm02_00310716 predicted 820
10 SASI_Mm02_00310717 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088136 predicted 477
2 SASI_Mm01_00088137 predicted 655
3 SASI_Mm01_00088138 predicted 332
4 SASI_Mm01_00088139 predicted 928
5 SASI_Mm01_00088140 predicted 1022
6 SASI_Mm01_00088141 predicted 582
7 SASI_Mm01_00088142 predicted 503
8 SASI_Mm01_00088143 predicted 1737
9 SASI_Mm01_00088144 predicted 795
10 SASI_Mm02_00320072 predicted 402
11 SASI_Mm01_00088145 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000447
VALIDATED
PSEN2 MISSION shRNA Bacterial Glycerol Stock
presenilin 2 (Alzheimer disease 4)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-1684s21c1
Sequence:CCGGCATCACGTTCGGGCTCATCTTCTCGAGAAGATGAGCCCGAACGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000447.2-2020s21c1
Sequence:CCGGTGAACTGAGAAGGTCAGATTACTCGAGTAATCTGACCTTCTCAGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-743s21c1
Sequence:CCGGATCAAGTCTGTGCGCTTCTACCTCGAGGTAGAAGCGCACAGACTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-1246s21c1
Sequence:CCGGTCTGAGAATGCTGGTAGAAACCTCGAGGTTTCTACCAGCATTCTCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-779s21c1
Sequence:CCGGCAGCTCATCTACACGCCATTCCTCGAGGAATGGCGTGTAGATGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-929s21c1
Sequence:CCGGATCCATGGCTGGTTGATCATGCTCGAGCATGATCAACCAGCCATGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-814s1c1
Sequence:CCGGCGTGGTTATGACCATCTTCTTCTCGAGAAGAAGATGGTCATAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-1879s1c1
Sequence:CCGGGCTGTTTCATCACCAGACTTTCTCGAGAAAGTCTGGTGATGAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-793s1c1
Sequence:CCGGCCTCATCATGATCAGCGTCATCTCGAGATGACGCTGATCATGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-904s1c1
Sequence:CCGGGCTGTTCCTCTTCACCTATATCTCGAGATATAGGTGAAGAGGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-811s1c1
Sequence:CCGGCATCGTGGTTATGACCATCTTCTCGAGAAGATGGTCATAACCACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000447
VALIDATED
PSEN2 MISSION shRNA shRNA Plasmid DNA
presenilin 2 (Alzheimer disease 4)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-1684s21c1
Sequence:CCGGCATCACGTTCGGGCTCATCTTCTCGAGAAGATGAGCCCGAACGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000447.2-2020s21c1
Sequence:CCGGTGAACTGAGAAGGTCAGATTACTCGAGTAATCTGACCTTCTCAGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-743s21c1
Sequence:CCGGATCAAGTCTGTGCGCTTCTACCTCGAGGTAGAAGCGCACAGACTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-1246s21c1
Sequence:CCGGTCTGAGAATGCTGGTAGAAACCTCGAGGTTTCTACCAGCATTCTCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-779s21c1
Sequence:CCGGCAGCTCATCTACACGCCATTCCTCGAGGAATGGCGTGTAGATGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-929s21c1
Sequence:CCGGATCCATGGCTGGTTGATCATGCTCGAGCATGATCAACCAGCCATGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-814s1c1
Sequence:CCGGCGTGGTTATGACCATCTTCTTCTCGAGAAGAAGATGGTCATAACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-1879s1c1
Sequence:CCGGGCTGTTTCATCACCAGACTTTCTCGAGAAAGTCTGGTGATGAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-793s1c1
Sequence:CCGGCCTCATCATGATCAGCGTCATCTCGAGATGACGCTGATCATGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-904s1c1
Sequence:CCGGGCTGTTCCTCTTCACCTATATCTCGAGATATAGGTGAAGAGGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-811s1c1
Sequence:CCGGCATCGTGGTTATGACCATCTTCTCGAGAAGATGGTCATAACCACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000447
VALIDATED
PSEN2 MISSION shRNA Lentiviral Transduction Particles
presenilin 2 (Alzheimer disease 4)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-1684s21c1
Sequence:CCGGCATCACGTTCGGGCTCATCTTCTCGAGAAGATGAGCCCGAACGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000447.2-2020s21c1
Sequence:CCGGTGAACTGAGAAGGTCAGATTACTCGAGTAATCTGACCTTCTCAGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-743s21c1
Sequence:CCGGATCAAGTCTGTGCGCTTCTACCTCGAGGTAGAAGCGCACAGACTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-1246s21c1
Sequence:CCGGTCTGAGAATGCTGGTAGAAACCTCGAGGTTTCTACCAGCATTCTCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-779s21c1
Sequence:CCGGCAGCTCATCTACACGCCATTCCTCGAGGAATGGCGTGTAGATGAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000447.2-929s21c1
Sequence:CCGGATCCATGGCTGGTTGATCATGCTCGAGCATGATCAACCAGCCATGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-814s1c1
Sequence:CCGGCGTGGTTATGACCATCTTCTTCTCGAGAAGAAGATGGTCATAACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-1879s1c1
Sequence:CCGGGCTGTTTCATCACCAGACTTTCTCGAGAAAGTCTGGTGATGAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-793s1c1
Sequence:CCGGCCTCATCATGATCAGCGTCATCTCGAGATGACGCTGATCATGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-904s1c1
Sequence:CCGGGCTGTTCCTCTTCACCTATATCTCGAGATATAGGTGAAGAGGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000447.1-811s1c1
Sequence:CCGGCATCGTGGTTATGACCATCTTCTCGAGAAGATGGTCATAACCACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011183
VALIDATED
PSEN2 MISSION shRNA Bacterial Glycerol Stock
presenilin 2 (Alzheimer disease 4)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011183.1-914s1c1
Sequence:CCGGCCTGATATACTCATCTGCCATCTCGAGATGGCAGATGAGTATATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011183.1-352s1c1
Sequence:CCGGCCACTATCAAGTCTGTGCGTTCTCGAGAACGCACAGACTTGATAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011183.1-725s1c1
Sequence:CCGGGCAGGCTTACCTTATTGTGATCTCGAGATCACAATAAGGTAAGCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011183.1-888s1c1
Sequence:CCGGGAGAGAAATGAGCCCATATTTCTCGAGAAATATGGGCTCATTTCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011183.1-506s1c1
Sequence:CCGGCCTCGTGGTACTCTACAAGTACTCGAGTACTTGTAGAGTACCACGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011183
VALIDATED
PSEN2 MISSION shRNA shRNA Plasmid DNA
presenilin 2 (Alzheimer disease 4)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011183.1-914s1c1
Sequence:CCGGCCTGATATACTCATCTGCCATCTCGAGATGGCAGATGAGTATATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011183.1-352s1c1
Sequence:CCGGCCACTATCAAGTCTGTGCGTTCTCGAGAACGCACAGACTTGATAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011183.1-725s1c1
Sequence:CCGGGCAGGCTTACCTTATTGTGATCTCGAGATCACAATAAGGTAAGCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011183.1-888s1c1
Sequence:CCGGGAGAGAAATGAGCCCATATTTCTCGAGAAATATGGGCTCATTTCTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011183.1-506s1c1
Sequence:CCGGCCTCGTGGTACTCTACAAGTACTCGAGTACTTGTAGAGTACCACGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011183
VALIDATED
PSEN2 MISSION shRNA Lentiviral Transduction Particles
presenilin 2 (Alzheimer disease 4)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011183.1-914s1c1
Sequence:CCGGCCTGATATACTCATCTGCCATCTCGAGATGGCAGATGAGTATATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011183.1-352s1c1
Sequence:CCGGCCACTATCAAGTCTGTGCGTTCTCGAGAACGCACAGACTTGATAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011183.1-725s1c1
Sequence:CCGGGCAGGCTTACCTTATTGTGATCTCGAGATCACAATAAGGTAAGCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011183.1-888s1c1
Sequence:CCGGGAGAGAAATGAGCCCATATTTCTCGAGAAATATGGGCTCATTTCTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011183.1-506s1c1
Sequence:CCGGCCTCGTGGTACTCTACAAGTACTCGAGTACTTGTAGAGTACCACGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)