EMAIL THIS PAGE TO A FRIEND

PSENEN

presenilin enhancer gamma secretase subunit

51 Gene Product Result for
Synonyms: MSTP064 PEN-2 PEN2
UniProtKB ID: Q9NZ42, B2R5L9
Gene ID:
Human(55851) Summary: Presenilins, which are components of the gamma-secretase protein complex, are required for intramembranous processing of some type I transmembrane proteins, such as the Notch proteins and the beta-amyloid precursor protein. Signaling by Notch receptors mediates a wide range of developmental cell fates. Processing of the beta-amyloid precursor protein generates neurotoxic amyloid beta peptides, the major component of senile plaques associated with Alzheimer's disease. This gene encodes a protein that is required for Notch pathway signaling, and for the activity and accumulation of gamma-secretase. [provided by RefSeq, Jul 2008]
Mouse(66340) presenilin enhancer 2 homolog (C. elegans)
Rat(292788) presenilin enhancer 2 homolog (C. elegans)
cow(493993) presenilin enhancer 2 homolog (C. elegans)
sheep(101120856) presenilin enhancer 2 homolog (C. elegans)
naked mole-rat(101700116) presenilin enhancer 2 homolog (C. elegans)
domestic guinea pig(100724086) presenilin enhancer 2 homolog (C. elegans)
Zebrafish(402810) presenilin enhancer 2 homolog
domestic cat(101084076) presenilin enhancer 2 homolog (C. elegans)
dog(476479) presenilin enhancer 2 homolog (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D5942 DAPT ≥98% (HPLC), solid human, mouse, rat pricing
L1790 L-685,458 >96% (HPLC), solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172341 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172341 Rosetta Predictions human pricing
NM_001008764 Rosetta Predictions rat pricing
NM_025498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173966 predicted 383
2 SASI_Hs01_00173967 predicted 340
3 SASI_Hs01_00173968 predicted 396
4 SASI_Hs01_00173969 predicted 344
5 SASI_Hs01_00173971 predicted 362
6 SASI_Hs01_00173972 predicted 221
7 SASI_Hs01_00173973 predicted 213
8 SASI_Hs01_00173975 predicted 407
9 SASI_Hs02_00367986 predicted 367
10 SASI_Hs02_00367987 predicted 220
11 SASI_Hs01_00173970 predicted 390
12 SASI_Hs01_00173974 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051654 predicted 257
2 SASI_Rn01_00051656 predicted 300
3 SASI_Rn02_00199263 predicted 297
4 SASI_Rn01_00051657 predicted 255
5 SASI_Rn01_00051658 predicted 247
6 SASI_Rn01_00051659 predicted 266
7 SASI_Rn01_00051660 predicted 294
8 SASI_Rn01_00051661 predicted 242
9 SASI_Rn01_00051662 predicted 225
10 SASI_Rn01_00051663 predicted 252
11 SASI_Rn01_00051655 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128408 predicted 256
2 SASI_Mm02_00328376 predicted 396
3 SASI_Mm01_00128411 predicted 253
4 SASI_Mm02_00328377 predicted 392
5 SASI_Mm01_00128413 predicted 373
6 SASI_Mm01_00128414 predicted 245
7 SASI_Mm02_00328378 predicted 250
8 SASI_Mm01_00128416 predicted 252
9 SASI_Mm02_00328379 predicted 245
10 SASI_Mm01_00128417 predicted 264
11 SASI_Mm01_00128409 predicted 360
12 SASI_Mm01_00128410 predicted 361
13 SASI_Mm01_00128412 predicted 355
14 SASI_Mm01_00128415 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025498
VALIDATED
PSENEN MISSION shRNA Bacterial Glycerol Stock
presenilin enhancer gamma secretase subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-404s1c1
Sequence:CCGGCTTCCTCTTCTGGGTGATCATCTCGAGATGATCACCCAGAAGAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-263s1c1
Sequence:CCGGGAAGTACTATCTTGGTGGATTCTCGAGAATCCACCAAGATAGTACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-255s1c1
Sequence:CCGGCTGTGCCGGAAGTACTATCTTCTCGAGAAGATAGTACTTCCGGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-367s1c1
Sequence:CCGGGCCAAATCAAAGGCTATGTTTCTCGAGAAACATAGCCTTTGATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-298s21c1
Sequence:CCGGTTCTTTGGTTAGTCAACATTTCTCGAGAAATGTTGACTAACCAAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-425s1c1
Sequence:CCGGTCTCGCCACCTGGATCACCATCTCGAGATGGTGATCCAGGTGGCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-484s21c1
Sequence:CCGGACTACCTCTCCTTCACCATTCCTCGAGGAATGGTGAAGGAGAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-263s21c1
Sequence:CCGGGAAGTACTATCTTGGTGGATTCTCGAGAATCCACCAAGATAGTACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-404s21c1
Sequence:CCGGCTTCCTCTTCTGGGTGATCATCTCGAGATGATCACCCAGAAGAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-323s21c1
Sequence:CCGGGTTCTTCAGAGAGGCGTTCCTCTCGAGAGGAACGCCTCTCTGAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025498
VALIDATED
PSENEN MISSION shRNA shRNA Plasmid DNA
presenilin enhancer gamma secretase subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-404s1c1
Sequence:CCGGCTTCCTCTTCTGGGTGATCATCTCGAGATGATCACCCAGAAGAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-263s1c1
Sequence:CCGGGAAGTACTATCTTGGTGGATTCTCGAGAATCCACCAAGATAGTACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-255s1c1
Sequence:CCGGCTGTGCCGGAAGTACTATCTTCTCGAGAAGATAGTACTTCCGGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-367s1c1
Sequence:CCGGGCCAAATCAAAGGCTATGTTTCTCGAGAAACATAGCCTTTGATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-298s21c1
Sequence:CCGGTTCTTTGGTTAGTCAACATTTCTCGAGAAATGTTGACTAACCAAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-425s1c1
Sequence:CCGGTCTCGCCACCTGGATCACCATCTCGAGATGGTGATCCAGGTGGCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-484s21c1
Sequence:CCGGACTACCTCTCCTTCACCATTCCTCGAGGAATGGTGAAGGAGAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-263s21c1
Sequence:CCGGGAAGTACTATCTTGGTGGATTCTCGAGAATCCACCAAGATAGTACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-404s21c1
Sequence:CCGGCTTCCTCTTCTGGGTGATCATCTCGAGATGATCACCCAGAAGAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-323s21c1
Sequence:CCGGGTTCTTCAGAGAGGCGTTCCTCTCGAGAGGAACGCCTCTCTGAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025498
VALIDATED
PSENEN MISSION shRNA Lentiviral Transduction Particles
presenilin enhancer gamma secretase subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-404s1c1
Sequence:CCGGCTTCCTCTTCTGGGTGATCATCTCGAGATGATCACCCAGAAGAGGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-263s1c1
Sequence:CCGGGAAGTACTATCTTGGTGGATTCTCGAGAATCCACCAAGATAGTACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-255s1c1
Sequence:CCGGCTGTGCCGGAAGTACTATCTTCTCGAGAAGATAGTACTTCCGGCACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-367s1c1
Sequence:CCGGGCCAAATCAAAGGCTATGTTTCTCGAGAAACATAGCCTTTGATTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-298s21c1
Sequence:CCGGTTCTTTGGTTAGTCAACATTTCTCGAGAAATGTTGACTAACCAAAGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025498.2-425s1c1
Sequence:CCGGTCTCGCCACCTGGATCACCATCTCGAGATGGTGATCCAGGTGGCGAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-484s21c1
Sequence:CCGGACTACCTCTCCTTCACCATTCCTCGAGGAATGGTGAAGGAGAGGTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-263s21c1
Sequence:CCGGGAAGTACTATCTTGGTGGATTCTCGAGAATCCACCAAGATAGTACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-404s21c1
Sequence:CCGGCTTCCTCTTCTGGGTGATCATCTCGAGATGATCACCCAGAAGAGGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025498.2-323s21c1
Sequence:CCGGGTTCTTCAGAGAGGCGTTCCTCTCGAGAGGAACGCCTCTCTGAAGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172341
VALIDATED
PSENEN MISSION shRNA Bacterial Glycerol Stock
presenilin enhancer gamma secretase subunit
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-313s21c1
Sequence:CCGGTTCTTCCGAGAGGCCTTCCTTCTCGAGAAGGAAGGCCTCTCGGAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-234s1c1
Sequence:CCGGGAAATTGAACCTGTGCCGGAACTCGAGTTCCGGCACAGGTTCAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-416s21c1
Sequence:CCGGTCACCTCCTGGATCACCATCTCTCGAGAGATGGTGATCCAGGAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-343s21c1
Sequence:CCGGTACACAGAACAGAGCCAAATCCTCGAGGATTTGGCTCTGTTCTGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172341.1-473s21c1
Sequence:CCGGACTACCTCTCCTTCACCATACCTCGAGGTATGGTGAAGGAGAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-239s21c1
Sequence:CCGGTGAACCTGTGCCGGAAGTACTCTCGAGAGTACTTCCGGCACAGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-287s21c1
Sequence:CCGGTTCTCTGGTTGGTCAACATCTCTCGAGAGATGTTGACCAACCAGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-299s21c1
Sequence:CCGGTCAACATCTTCTGGTTCTTCCCTCGAGGGAAGAACCAGAAGATGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-328s21c1
Sequence:CCGGTTCCTTGTCCCAGCCTACACACTCGAGTGTGTAGGCTGGGACAAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-354s1c1
Sequence:CCGGGAGCCAAATCAAAGGCTATGTCTCGAGACATAGCCTTTGATTTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-298s1c1
Sequence:CCGGGTCAACATCTTCTGGTTCTTCCTCGAGGAAGAACCAGAAGATGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-426s1c1
Sequence:CCGGGATCACCATCTTCCAGATCTACTCGAGTAGATCTGGAAGATGGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-352s1c1
Sequence:CCGGCAGAGCCAAATCAAAGGCTATCTCGAGATAGCCTTTGATTTGGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-423s1c1
Sequence:CCGGCTGGATCACCATCTTCCAGATCTCGAGATCTGGAAGATGGTGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-393s1c1
Sequence:CCGGCTTCCTCTTCTGGGTGATAGTCTCGAGACTATCACCCAGAAGAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172341
VALIDATED
PSENEN MISSION shRNA shRNA Plasmid DNA
presenilin enhancer gamma secretase subunit
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-313s21c1
Sequence:CCGGTTCTTCCGAGAGGCCTTCCTTCTCGAGAAGGAAGGCCTCTCGGAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-234s1c1
Sequence:CCGGGAAATTGAACCTGTGCCGGAACTCGAGTTCCGGCACAGGTTCAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-416s21c1
Sequence:CCGGTCACCTCCTGGATCACCATCTCTCGAGAGATGGTGATCCAGGAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-343s21c1
Sequence:CCGGTACACAGAACAGAGCCAAATCCTCGAGGATTTGGCTCTGTTCTGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172341.1-473s21c1
Sequence:CCGGACTACCTCTCCTTCACCATACCTCGAGGTATGGTGAAGGAGAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-239s21c1
Sequence:CCGGTGAACCTGTGCCGGAAGTACTCTCGAGAGTACTTCCGGCACAGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-287s21c1
Sequence:CCGGTTCTCTGGTTGGTCAACATCTCTCGAGAGATGTTGACCAACCAGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-299s21c1
Sequence:CCGGTCAACATCTTCTGGTTCTTCCCTCGAGGGAAGAACCAGAAGATGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-328s21c1
Sequence:CCGGTTCCTTGTCCCAGCCTACACACTCGAGTGTGTAGGCTGGGACAAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-354s1c1
Sequence:CCGGGAGCCAAATCAAAGGCTATGTCTCGAGACATAGCCTTTGATTTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-298s1c1
Sequence:CCGGGTCAACATCTTCTGGTTCTTCCTCGAGGAAGAACCAGAAGATGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-426s1c1
Sequence:CCGGGATCACCATCTTCCAGATCTACTCGAGTAGATCTGGAAGATGGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-352s1c1
Sequence:CCGGCAGAGCCAAATCAAAGGCTATCTCGAGATAGCCTTTGATTTGGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-423s1c1
Sequence:CCGGCTGGATCACCATCTTCCAGATCTCGAGATCTGGAAGATGGTGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-393s1c1
Sequence:CCGGCTTCCTCTTCTGGGTGATAGTCTCGAGACTATCACCCAGAAGAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172341
VALIDATED
PSENEN MISSION shRNA Lentiviral Transduction Particles
presenilin enhancer gamma secretase subunit
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-313s21c1
Sequence:CCGGTTCTTCCGAGAGGCCTTCCTTCTCGAGAAGGAAGGCCTCTCGGAAGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-234s1c1
Sequence:CCGGGAAATTGAACCTGTGCCGGAACTCGAGTTCCGGCACAGGTTCAATTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-416s21c1
Sequence:CCGGTCACCTCCTGGATCACCATCTCTCGAGAGATGGTGATCCAGGAGGTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-343s21c1
Sequence:CCGGTACACAGAACAGAGCCAAATCCTCGAGGATTTGGCTCTGTTCTGTGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172341.1-473s21c1
Sequence:CCGGACTACCTCTCCTTCACCATACCTCGAGGTATGGTGAAGGAGAGGTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-239s21c1
Sequence:CCGGTGAACCTGTGCCGGAAGTACTCTCGAGAGTACTTCCGGCACAGGTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-287s21c1
Sequence:CCGGTTCTCTGGTTGGTCAACATCTCTCGAGAGATGTTGACCAACCAGAGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-299s21c1
Sequence:CCGGTCAACATCTTCTGGTTCTTCCCTCGAGGGAAGAACCAGAAGATGTTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_172341.1-328s21c1
Sequence:CCGGTTCCTTGTCCCAGCCTACACACTCGAGTGTGTAGGCTGGGACAAGGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-354s1c1
Sequence:CCGGGAGCCAAATCAAAGGCTATGTCTCGAGACATAGCCTTTGATTTGGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-298s1c1
Sequence:CCGGGTCAACATCTTCTGGTTCTTCCTCGAGGAAGAACCAGAAGATGTTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-426s1c1
Sequence:CCGGGATCACCATCTTCCAGATCTACTCGAGTAGATCTGGAAGATGGTGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-352s1c1
Sequence:CCGGCAGAGCCAAATCAAAGGCTATCTCGAGATAGCCTTTGATTTGGCTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-423s1c1
Sequence:CCGGCTGGATCACCATCTTCCAGATCTCGAGATCTGGAAGATGGTGATCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172341.1-393s1c1
Sequence:CCGGCTTCCTCTTCTGGGTGATAGTCTCGAGACTATCACCCAGAAGAGGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)