EMAIL THIS PAGE TO A FRIEND

PSG11

pregnancy specific beta-1-glycoprotein 11

55 Gene Product Result for
Synonyms: PSBG-11 PSBG-13 PSG13 PSG14
Species: Human PSG11(5680)
UniProtKB ID: Q9UQ72, Q13179, Q15242, Q8WW91, Q9UNE4
Gene ID:
Human(5680) Summary: The human pregnancy-specific glycoproteins (PSGs) are a group of molecules that are mainly produced by the placental syncytiotrophoblasts during pregnancy. PSGs comprise a subgroup of the carcinoembryonic antigen (CEA) family, which belongs to the immunoglobulin superfamily. For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002785 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002785 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002785 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231501 MISSION® esiRNA esiRNA targeting human PSG11 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113410 Rosetta Predictions human pricing
NM_002785 Rosetta Predictions human pricing
NM_203287 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325831 predicted 485
2 SASI_Hs02_00325832 predicted 476
3 SASI_Hs02_00325833 predicted 506
4 SASI_Hs02_00325834 predicted 473
5 SASI_Hs02_00325835 predicted 475
6 SASI_Hs02_00325836 predicted 484
7 SASI_Hs02_00325837 predicted 475
8 SASI_Hs02_00325838 predicted 511
9 SASI_Hs02_00325839 predicted 490
10 SASI_Hs02_00325840 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158554 predicted 853
2 SASI_Hs01_00158555 predicted 834
3 SASI_Hs01_00158556 predicted 872
4 SASI_Hs01_00158558 predicted 838
5 SASI_Hs01_00158559 predicted 842
6 SASI_Hs01_00158560 predicted 845
7 SASI_Hs01_00158561 predicted 841
8 SASI_Hs01_00158562 predicted 874
9 SASI_Hs01_00158563 predicted 854
10 SASI_Hs02_00334421 predicted 1063
11 SASI_Hs01_00158557 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097798 predicted 478
2 SASI_Hs01_00097799 predicted 469
3 SASI_Hs01_00097800 predicted 502
4 SASI_Hs01_00097803 predicted 468
5 SASI_Hs01_00097804 predicted 478
6 SASI_Hs01_00097805 predicted 480
7 SASI_Hs01_00097806 predicted 473
8 SASI_Hs01_00097807 predicted 509
9 SASI_Hs02_00373191 predicted 484
10 SASI_Hs02_00373192 predicted 699
11 SASI_Hs01_00097801 predicted 500
12 SASI_Hs01_00097802 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002785
PSG11 MISSION shRNA Bacterial Glycerol Stock
pregnancy specific beta-1-glycoprotein 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002785.2-1098s21c1
Sequence:CCGGTTCAATAATCCAACGTAGCAGCTCGAGCTGCTACGTTGGATTATTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002785.2-973s1c1
Sequence:CCGGCTCAGATTACTCCAAAGCATACTCGAGTATGCTTTGGAGTAATCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002785.2-984s1c1
Sequence:CCGGCCAAAGCATAATGGGCTCTATCTCGAGATAGAGCCCATTATGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002785.2-894s21c1
Sequence:CCGGGCAAACTCTAACCCACCAGCACTCGAGTGCTGGTGGGTTAGAGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002785.2-678s21c1
Sequence:CCGGCATAGGATGCAGCTGTCTGAACTCGAGTTCAGACAGCTGCATCCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002785.2-596s1c1
Sequence:CCGGGACTGTGATCTTAACCTGTAACTCGAGTTACAGGTTAAGATCACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002785.2-1300s21c1
Sequence:CCGCTCCATTTCATTGGACTAAATACTCGAGTATTTAGTCCAATGAAATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002785.2-912s1c1
Sequence:CCGGGCACAGTATTCTTGGACAATTCTCGAGAATTGTCCAAGAATACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002785
PSG11 MISSION shRNA shRNA Plasmid DNA
pregnancy specific beta-1-glycoprotein 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002785.2-1098s21c1
Sequence:CCGGTTCAATAATCCAACGTAGCAGCTCGAGCTGCTACGTTGGATTATTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002785.2-973s1c1
Sequence:CCGGCTCAGATTACTCCAAAGCATACTCGAGTATGCTTTGGAGTAATCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002785.2-984s1c1
Sequence:CCGGCCAAAGCATAATGGGCTCTATCTCGAGATAGAGCCCATTATGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002785.2-894s21c1
Sequence:CCGGGCAAACTCTAACCCACCAGCACTCGAGTGCTGGTGGGTTAGAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002785.2-678s21c1
Sequence:CCGGCATAGGATGCAGCTGTCTGAACTCGAGTTCAGACAGCTGCATCCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002785.2-596s1c1
Sequence:CCGGGACTGTGATCTTAACCTGTAACTCGAGTTACAGGTTAAGATCACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002785.2-1300s21c1
Sequence:CCGCTCCATTTCATTGGACTAAATACTCGAGTATTTAGTCCAATGAAATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002785.2-912s1c1
Sequence:CCGGGCACAGTATTCTTGGACAATTCTCGAGAATTGTCCAAGAATACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002785
PSG11 MISSION shRNA Lentiviral Transduction Particles
pregnancy specific beta-1-glycoprotein 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002785.2-1098s21c1
Sequence:CCGGTTCAATAATCCAACGTAGCAGCTCGAGCTGCTACGTTGGATTATTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002785.2-973s1c1
Sequence:CCGGCTCAGATTACTCCAAAGCATACTCGAGTATGCTTTGGAGTAATCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002785.2-984s1c1
Sequence:CCGGCCAAAGCATAATGGGCTCTATCTCGAGATAGAGCCCATTATGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002785.2-894s21c1
Sequence:CCGGGCAAACTCTAACCCACCAGCACTCGAGTGCTGGTGGGTTAGAGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002785.2-678s21c1
Sequence:CCGGCATAGGATGCAGCTGTCTGAACTCGAGTTCAGACAGCTGCATCCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002785.2-596s1c1
Sequence:CCGGGACTGTGATCTTAACCTGTAACTCGAGTTACAGGTTAAGATCACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002785.2-1300s21c1
Sequence:CCGCTCCATTTCATTGGACTAAATACTCGAGTATTTAGTCCAATGAAATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002785.2-912s1c1
Sequence:CCGGGCACAGTATTCTTGGACAATTCTCGAGAATTGTCCAAGAATACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)