EMAIL THIS PAGE TO A FRIEND

PSG1

pregnancy specific beta-1-glycoprotein 1

9 Gene Product Result for
Synonyms: B1G1 CD66f DHFRP2 FL-NCA-1/2 PBG1 PS-beta-C/D PS-beta-G-1 PSBG-1 PSBG1 PSG95 PSGGA PSGIIA SP1
Species: Human PSG1(5669)
Gene ID:
Human(5669) Summary: The human placenta is a multihormonal endocrine organ that produces hormones, enzymes, and other molecules that support fetal survival and development. Pregnancy-specific beta-1-glycoprotein (PSBG, PSG) is a major product of the syncytiotrophoblast, reaching concentrations of 100 to 290 mg/l at term in the serum of pregnant women (Horne et al., 1976 [PubMed 971765]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412687 ANTI-PSG1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006905 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006905 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197152 predicted 1271
2 SASI_Hs01_00197154 predicted 1274
3 SASI_Hs01_00197156 predicted 1395
4 SASI_Hs01_00197151 predicted 413
5 SASI_Hs01_00197153 predicted 422
6 SASI_Hs01_00197155 predicted 350
7 SASI_Hs01_00197157 predicted 1351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006905
PSG1 MISSION shRNA Bacterial Glycerol Stock
pregnancy specific beta-1-glycoprotein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006905.2-1592s1c1
Sequence:CCGGCCAAGCAGGAAGAACATTGATCTCGAGATCAATGTTCTTCCTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006905.2-1283s1c1
Sequence:CCGGGCCATATTACTACAAAGCATACTCGAGTATGCTTTGTAGTAATATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006905.2-773s1c1
Sequence:CCGGCAGGACCCTATGAATGTGAAACTCGAGTTTCACATTCATAGGGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006905.2-861s1c1
Sequence:CCGGGCCCTACATCACCATCAACAACTCGAGTTGTTGATGGTGATGTAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006905.2-315s1c1
Sequence:CCGGCCAGAATCTTACCGGCTACATCTCGAGATGTAGCCGGTAAGATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006905.2-1368s21c1
Sequence:CCGGAGTCGAAGTCTCTGGTAAGTGCTCGAGCACTTACCAGAGACTTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006905.2-1758s21c1
Sequence:CCGGATACTTCTGGGAACCGTAATTCTCGAGAATTACGGTTCCCAGAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006905.2-1723s21c1
Sequence:CCGGTAATCTATCTACAGCTTATAGCTCGAGCTATAAGCTGTAGATAGATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006905
PSG1 MISSION shRNA shRNA Plasmid DNA
pregnancy specific beta-1-glycoprotein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006905.2-1592s1c1
Sequence:CCGGCCAAGCAGGAAGAACATTGATCTCGAGATCAATGTTCTTCCTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006905.2-1283s1c1
Sequence:CCGGGCCATATTACTACAAAGCATACTCGAGTATGCTTTGTAGTAATATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006905.2-773s1c1
Sequence:CCGGCAGGACCCTATGAATGTGAAACTCGAGTTTCACATTCATAGGGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006905.2-861s1c1
Sequence:CCGGGCCCTACATCACCATCAACAACTCGAGTTGTTGATGGTGATGTAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006905.2-315s1c1
Sequence:CCGGCCAGAATCTTACCGGCTACATCTCGAGATGTAGCCGGTAAGATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006905.2-1368s21c1
Sequence:CCGGAGTCGAAGTCTCTGGTAAGTGCTCGAGCACTTACCAGAGACTTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006905.2-1758s21c1
Sequence:CCGGATACTTCTGGGAACCGTAATTCTCGAGAATTACGGTTCCCAGAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006905.2-1723s21c1
Sequence:CCGGTAATCTATCTACAGCTTATAGCTCGAGCTATAAGCTGTAGATAGATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006905
PSG1 MISSION shRNA Lentiviral Transduction Particles
pregnancy specific beta-1-glycoprotein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006905.2-1592s1c1
Sequence:CCGGCCAAGCAGGAAGAACATTGATCTCGAGATCAATGTTCTTCCTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006905.2-1283s1c1
Sequence:CCGGGCCATATTACTACAAAGCATACTCGAGTATGCTTTGTAGTAATATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006905.2-773s1c1
Sequence:CCGGCAGGACCCTATGAATGTGAAACTCGAGTTTCACATTCATAGGGTCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006905.2-861s1c1
Sequence:CCGGGCCCTACATCACCATCAACAACTCGAGTTGTTGATGGTGATGTAGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006905.2-315s1c1
Sequence:CCGGCCAGAATCTTACCGGCTACATCTCGAGATGTAGCCGGTAAGATTCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006905.2-1368s21c1
Sequence:CCGGAGTCGAAGTCTCTGGTAAGTGCTCGAGCACTTACCAGAGACTTCGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006905.2-1758s21c1
Sequence:CCGGATACTTCTGGGAACCGTAATTCTCGAGAATTACGGTTCCCAGAAGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006905.2-1723s21c1
Sequence:CCGGTAATCTATCTACAGCTTATAGCTCGAGCTATAAGCTGTAGATAGATTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)