EMAIL THIS PAGE TO A FRIEND

PSG2

pregnancy specific beta-1-glycoprotein 2

35 Gene Product Result for
Synonyms: CEA PSBG2 PSG1
Species: Human PSG2(5670)
UniProtKB ID: P11465, Q8TCD9, Q9UEA4, Q9UQ78
Gene ID:
Human(5670) Summary: The human pregnancy-specific glycoproteins (PSGs) are a family of proteins that are synthesized in large amounts by placental trophoblasts and released into the maternal circulation during pregnancy. Molecular cloning and analysis of several PSG genes has indicated that the PSGs form a subgroup of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily of genes. Members of the CEA family consist of a single N domain, with structural similarity to the immunoglobulin variable domains, followed by a variable number of immunoglobulin constant-like A and/or B domains. Most PSGs have an arg-gly-asp (RGD) motif, which has been shown to function as an adhesion recognition signal for several integrins, in the N-terminal domain (summary by Teglund et al., 1994 [PubMed 7851896]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031246 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031246 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137975 predicted 830
2 SASI_Hs01_00137978 predicted 615
3 SASI_Hs02_00358650 predicted 1041
4 SASI_Hs02_00358651 predicted 1025
5 SASI_Hs01_00137974 predicted 848
6 SASI_Hs01_00137976 predicted 483
7 SASI_Hs01_00137977 predicted 486
8 SASI_Hs01_00137979 predicted 903
9 SASI_Hs01_00137980 predicted 583
10 SASI_Hs01_00137981 predicted 573
11 SASI_Hs01_00137982 predicted 907
12 SASI_Hs01_00137983 predicted 190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031246
PSG2 MISSION shRNA Bacterial Glycerol Stock
pregnancy specific beta-1-glycoprotein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031246.1-949s1c1
Sequence:CCGGCCCAAATTACTACAAAGCATACTCGAGTATGCTTTGTAGTAATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031246.2-1145s21c1
Sequence:CCGGATTTATGGAAAGGTCTCTTACCTCGAGGTAAGAGACCTTTCCATAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031246.1-565s1c1
Sequence:CCGGCCATGGAAACTGTGATCTTAACTCGAGTTAAGATCACAGTTTCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031246.2-1033s21c1
Sequence:CCGGACATCGTTGACAGTCAAAGTCCTCGAGGACTTTGACTGTCAACGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031246.2-825s21c1
Sequence:CCGGTCACCCTTCATACACCAATTACTCGAGTAATTGGTGTATGAAGGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031246.2-1242s21c1
Sequence:CCGGCAGGCTGATACTTCATGAAATCTCGAGATTTCATGAAGTATCAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031246.1-1337s1c1
Sequence:CCGGGTGCTGATTCTTGGAATGTTTCTCGAGAAACATTCCAAGAATCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031246.1-260s1c1
Sequence:CCGGCCAGAATCTTACTGGCTACATCTCGAGATGTAGCCAGTAAGATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031246.1-718s1c1
Sequence:CCGGCAGGACCCTATGAATGTGAAACTCGAGTTTCACATTCATAGGGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183276    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031246.1-1094s1c1
Sequence:CCGGGCTGTGATGTCATTTCTGTATCTCGAGATACAGAAATGACATCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031246.1-1177s1c1
Sequence:CCGGCCTGATAACTTCAAGATCATACTCGAGTATGATCTTGAAGTTATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031246
PSG2 MISSION shRNA shRNA Plasmid DNA
pregnancy specific beta-1-glycoprotein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031246.1-949s1c1
Sequence:CCGGCCCAAATTACTACAAAGCATACTCGAGTATGCTTTGTAGTAATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031246.2-1145s21c1
Sequence:CCGGATTTATGGAAAGGTCTCTTACCTCGAGGTAAGAGACCTTTCCATAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031246.1-565s1c1
Sequence:CCGGCCATGGAAACTGTGATCTTAACTCGAGTTAAGATCACAGTTTCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031246.2-1033s21c1
Sequence:CCGGACATCGTTGACAGTCAAAGTCCTCGAGGACTTTGACTGTCAACGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031246.2-825s21c1
Sequence:CCGGTCACCCTTCATACACCAATTACTCGAGTAATTGGTGTATGAAGGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031246.2-1242s21c1
Sequence:CCGGCAGGCTGATACTTCATGAAATCTCGAGATTTCATGAAGTATCAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031246.1-1337s1c1
Sequence:CCGGGTGCTGATTCTTGGAATGTTTCTCGAGAAACATTCCAAGAATCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031246.1-260s1c1
Sequence:CCGGCCAGAATCTTACTGGCTACATCTCGAGATGTAGCCAGTAAGATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031246.1-718s1c1
Sequence:CCGGCAGGACCCTATGAATGTGAAACTCGAGTTTCACATTCATAGGGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183276    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031246.1-1094s1c1
Sequence:CCGGGCTGTGATGTCATTTCTGTATCTCGAGATACAGAAATGACATCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031246.1-1177s1c1
Sequence:CCGGCCTGATAACTTCAAGATCATACTCGAGTATGATCTTGAAGTTATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031246
PSG2 MISSION shRNA Lentiviral Transduction Particles
pregnancy specific beta-1-glycoprotein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031246.1-949s1c1
Sequence:CCGGCCCAAATTACTACAAAGCATACTCGAGTATGCTTTGTAGTAATTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031246.2-1145s21c1
Sequence:CCGGATTTATGGAAAGGTCTCTTACCTCGAGGTAAGAGACCTTTCCATAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031246.1-565s1c1
Sequence:CCGGCCATGGAAACTGTGATCTTAACTCGAGTTAAGATCACAGTTTCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031246.2-1033s21c1
Sequence:CCGGACATCGTTGACAGTCAAAGTCCTCGAGGACTTTGACTGTCAACGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031246.2-825s21c1
Sequence:CCGGTCACCCTTCATACACCAATTACTCGAGTAATTGGTGTATGAAGGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031246.2-1242s21c1
Sequence:CCGGCAGGCTGATACTTCATGAAATCTCGAGATTTCATGAAGTATCAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031246.1-1337s1c1
Sequence:CCGGGTGCTGATTCTTGGAATGTTTCTCGAGAAACATTCCAAGAATCAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031246.1-260s1c1
Sequence:CCGGCCAGAATCTTACTGGCTACATCTCGAGATGTAGCCAGTAAGATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031246.1-718s1c1
Sequence:CCGGCAGGACCCTATGAATGTGAAACTCGAGTTTCACATTCATAGGGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183276    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031246.1-1094s1c1
Sequence:CCGGGCTGTGATGTCATTTCTGTATCTCGAGATACAGAAATGACATCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031246.1-1177s1c1
Sequence:CCGGCCTGATAACTTCAAGATCATACTCGAGTATGATCTTGAAGTTATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)