EMAIL THIS PAGE TO A FRIEND

PSG3

pregnancy specific beta-1-glycoprotein 3

20 Gene Product Result for
Species: Human PSG3(5671)
UniProtKB ID: Q16557, Q08265, Q9BRW2, Q9UPL4, Q9UQ77
Gene ID:
Human(5671) Summary: The human pregnancy-specific glycoproteins (PSGs) are a family of proteins that are synthesized in large amounts by placental trophoblasts and released into the maternal circulation during pregnancy. Molecular cloning and analysis of several PSG genes has indicated that the PSGs form a subgroup of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily of genes. Members of the CEA family consist of a single N domain, with structural similarity to the immunoglobulin variable domains, followed by a variable number of immunoglobulin constant-like A and/or B domains. Most PSGs have an arg-gly-asp (RGD) motif, which has been shown to function as an adhesion recognition signal for several integrins, in the N-terminal domain (summary by Teglund et al., 1994 [PubMed 7851896]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021016 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221861 MISSION® esiRNA esiRNA targeting human PSG3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021016 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105769 predicted 1383
2 SASI_Hs01_00105770 predicted 1396
3 SASI_Hs01_00105768 predicted 1466
4 SASI_Hs01_00105771 predicted 1373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021016
VALIDATED
PSG3 MISSION shRNA Bacterial Glycerol Stock
pregnancy specific beta-1-glycoprotein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021016.2-1123s1c1
Sequence:CCGGCCCAGTGTCACGAGAAATGAACTCGAGTTCATTTCTCGTGACACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021016.2-351s1c1
Sequence:CCGGCGAGCCAACCAAAGTTTCCAACTCGAGTTGGAAACTTTGGTTGGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021016.2-865s1c1
Sequence:CCGGGCAGGACCCTATGAATGTGAACTCGAGTTCACATTCATAGGGTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021016.2-721s1c1
Sequence:CCGGGCTGTGAGCTTAACCTGTGATCTCGAGATCACAGGTTAAGCTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021016.2-1312s1c1
Sequence:CCGGCCAGCAGAATATTCTTGGACACTCGAGTGTCCAAGAATATTCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021016.2-1408s1c1
Sequence:CCGGGCTTGCTCTGTTCGTAACTCACTCGAGTGAGTTACGAACAGAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021016.3-1629s21c1
Sequence:CCGGGGCTGATACTTCATGAAATTCCTCGAGGAATTTCATGAAGTATCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021016.2-418s1c1
Sequence:CCGGGCTGGCTACATCTGGTACAAACTCGAGTTTGTACCAGATGTAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021016.3-368s21c1
Sequence:CCGGTTACATCATACGTAGTAGATGCTCGAGCATCTACTACGTATGATGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021016.3-1398s21c1
Sequence:CCGGTCCTGGCCTTAATCCATTATACTCGAGTATAATGGATTAAGGCCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021016
VALIDATED
PSG3 MISSION shRNA shRNA Plasmid DNA
pregnancy specific beta-1-glycoprotein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021016.2-1123s1c1
Sequence:CCGGCCCAGTGTCACGAGAAATGAACTCGAGTTCATTTCTCGTGACACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021016.2-351s1c1
Sequence:CCGGCGAGCCAACCAAAGTTTCCAACTCGAGTTGGAAACTTTGGTTGGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021016.2-865s1c1
Sequence:CCGGGCAGGACCCTATGAATGTGAACTCGAGTTCACATTCATAGGGTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021016.2-721s1c1
Sequence:CCGGGCTGTGAGCTTAACCTGTGATCTCGAGATCACAGGTTAAGCTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021016.2-1312s1c1
Sequence:CCGGCCAGCAGAATATTCTTGGACACTCGAGTGTCCAAGAATATTCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021016.2-1408s1c1
Sequence:CCGGGCTTGCTCTGTTCGTAACTCACTCGAGTGAGTTACGAACAGAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021016.3-1629s21c1
Sequence:CCGGGGCTGATACTTCATGAAATTCCTCGAGGAATTTCATGAAGTATCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021016.2-418s1c1
Sequence:CCGGGCTGGCTACATCTGGTACAAACTCGAGTTTGTACCAGATGTAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021016.3-368s21c1
Sequence:CCGGTTACATCATACGTAGTAGATGCTCGAGCATCTACTACGTATGATGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021016.3-1398s21c1
Sequence:CCGGTCCTGGCCTTAATCCATTATACTCGAGTATAATGGATTAAGGCCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021016
VALIDATED
PSG3 MISSION shRNA Lentiviral Transduction Particles
pregnancy specific beta-1-glycoprotein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021016.2-1123s1c1
Sequence:CCGGCCCAGTGTCACGAGAAATGAACTCGAGTTCATTTCTCGTGACACTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021016.2-351s1c1
Sequence:CCGGCGAGCCAACCAAAGTTTCCAACTCGAGTTGGAAACTTTGGTTGGCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021016.2-865s1c1
Sequence:CCGGGCAGGACCCTATGAATGTGAACTCGAGTTCACATTCATAGGGTCCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021016.2-721s1c1
Sequence:CCGGGCTGTGAGCTTAACCTGTGATCTCGAGATCACAGGTTAAGCTCACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021016.2-1312s1c1
Sequence:CCGGCCAGCAGAATATTCTTGGACACTCGAGTGTCCAAGAATATTCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021016.2-1408s1c1
Sequence:CCGGGCTTGCTCTGTTCGTAACTCACTCGAGTGAGTTACGAACAGAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021016.3-1629s21c1
Sequence:CCGGGGCTGATACTTCATGAAATTCCTCGAGGAATTTCATGAAGTATCAGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021016.2-418s1c1
Sequence:CCGGGCTGGCTACATCTGGTACAAACTCGAGTTTGTACCAGATGTAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021016.3-368s21c1
Sequence:CCGGTTACATCATACGTAGTAGATGCTCGAGCATCTACTACGTATGATGTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021016.3-1398s21c1
Sequence:CCGGTCCTGGCCTTAATCCATTATACTCGAGTATAATGGATTAAGGCCAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)