EMAIL THIS PAGE TO A FRIEND

PSG4

pregnancy specific beta-1-glycoprotein 4

59 Gene Product Result for
Synonyms: PSG9
Species: Human PSG4(5672)
UniProtKB ID: Q00888, Q13047, Q13048, Q15234, Q15240, Q9UQ76
Gene ID:
Human(5672) Summary: The human pregnancy-specific glycoproteins (PSGs) are a family of proteins that are synthesized in large amounts by placental trophoblasts and released into the maternal circulation during pregnancy. Molecular cloning and analysis of several PSG genes has indicated that the PSGs form a subgroup of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily of genes. Members of the CEA family consist of a single N domain, with structural similarity to the immunoglobulin variable domains, followed by a variable number of immunoglobulin constant-like A and/or B domains. Most PSGs have an arg-gly-asp (RGD) motif, which has been shown to function as an adhesion recognition signal for several integrins, in the N-terminal domain (summary by Teglund et al., 1994 [PubMed 7851896]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002780 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002780 Rosetta Predictions human pricing
NM_213633 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056735 predicted 347
2 SASI_Hs01_00056736 predicted 359
3 SASI_Hs01_00056737 predicted 387
4 SASI_Hs01_00056738 predicted 282
5 SASI_Hs01_00056739 predicted 284
6 SASI_Hs01_00056740 predicted 1202
7 SASI_Hs01_00056741 predicted 1254
8 SASI_Hs01_00056742 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093448 predicted 344
2 SASI_Hs01_00093449 predicted 358
3 SASI_Hs01_00093450 predicted 385
4 SASI_Hs01_00093451 predicted 277
5 SASI_Hs01_00093452 predicted 280
6 SASI_Hs01_00093453 predicted 925
7 SASI_Hs01_00093454 predicted 965
8 SASI_Hs01_00093455 predicted 918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002780
PSG4 MISSION shRNA Bacterial Glycerol Stock
pregnancy specific beta-1-glycoprotein 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002780.3-1173s21c1
Sequence:CCGGGTCTAACCCACGGGCACAATACTCGAGTATTGTGCCCGTGGGTTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002780.3-319s21c1
Sequence:CCGGACATACCTCTACCATTACATTCTCGAGAATGTAATGGTAGAGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002780.3-179s21c1
Sequence:CCGGACTTCTGGAATCCGCCCACAACTCGAGTTGTGGGCGGATTCCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-614s1c1
Sequence:CCGGGCTGTGATCTTAACCTGTGATCTCGAGATCACAGGTTAAGATCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-1026s1c1
Sequence:CCGGCGAGAAATGAAACAGGACCTTCTCGAGAAGGTCCTGTTTCATTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-1339s1c1
Sequence:CCGGCTCCAAATCCATCACAGTCAACTCGAGTTGACTGTGATGGATTTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-847s1c1
Sequence:CCGGGCCCTACATCACAATCAACAACTCGAGTTGTTGATTGTGATGTAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-480s1c1
Sequence:CCGGCCTACACCTTACACATCATAACTCGAGTTATGATGTGTAAGGTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002780
PSG4 MISSION shRNA shRNA Plasmid DNA
pregnancy specific beta-1-glycoprotein 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002780.3-1173s21c1
Sequence:CCGGGTCTAACCCACGGGCACAATACTCGAGTATTGTGCCCGTGGGTTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002780.3-319s21c1
Sequence:CCGGACATACCTCTACCATTACATTCTCGAGAATGTAATGGTAGAGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002780.3-179s21c1
Sequence:CCGGACTTCTGGAATCCGCCCACAACTCGAGTTGTGGGCGGATTCCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-614s1c1
Sequence:CCGGGCTGTGATCTTAACCTGTGATCTCGAGATCACAGGTTAAGATCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-1026s1c1
Sequence:CCGGCGAGAAATGAAACAGGACCTTCTCGAGAAGGTCCTGTTTCATTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-1339s1c1
Sequence:CCGGCTCCAAATCCATCACAGTCAACTCGAGTTGACTGTGATGGATTTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-847s1c1
Sequence:CCGGGCCCTACATCACAATCAACAACTCGAGTTGTTGATTGTGATGTAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-480s1c1
Sequence:CCGGCCTACACCTTACACATCATAACTCGAGTTATGATGTGTAAGGTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002780
PSG4 MISSION shRNA Lentiviral Transduction Particles
pregnancy specific beta-1-glycoprotein 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002780.3-1173s21c1
Sequence:CCGGGTCTAACCCACGGGCACAATACTCGAGTATTGTGCCCGTGGGTTAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002780.3-319s21c1
Sequence:CCGGACATACCTCTACCATTACATTCTCGAGAATGTAATGGTAGAGGTATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002780.3-179s21c1
Sequence:CCGGACTTCTGGAATCCGCCCACAACTCGAGTTGTGGGCGGATTCCAGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-614s1c1
Sequence:CCGGGCTGTGATCTTAACCTGTGATCTCGAGATCACAGGTTAAGATCACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-1026s1c1
Sequence:CCGGCGAGAAATGAAACAGGACCTTCTCGAGAAGGTCCTGTTTCATTTCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-1339s1c1
Sequence:CCGGCTCCAAATCCATCACAGTCAACTCGAGTTGACTGTGATGGATTTGGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-847s1c1
Sequence:CCGGGCCCTACATCACAATCAACAACTCGAGTTGTTGATTGTGATGTAGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002780.2-480s1c1
Sequence:CCGGCCTACACCTTACACATCATAACTCGAGTTATGATGTGTAAGGTGTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)