EMAIL THIS PAGE TO A FRIEND

PSG6

pregnancy specific beta-1-glycoprotein 6

22 Gene Product Result for
Synonyms: PSBG-10 PSBG-12 PSBG-6 PSG10 PSGGB
Species: Human PSG6(5675)
UniProtKB ID: Q00889, O75244, Q15224, Q15235, Q549K1
Gene ID:
Human(5675) Summary: This gene is a member of the pregnancy-specific glycoprotein (PSG) gene family. The PSG genes are a subgroup of the carcinoembryonic antigen (CEA) family of immunoglobulin-like genes, and are found in a gene cluster at 19q13.1-q13.2 telomeric to another cluster of CEA-related genes. The PSG genes are expressed by placental trophoblasts and released into the maternal circulation during pregnancy, and are thought to be essential for maintenance of normal pregnancy. The protein encoded by this gene contains the Arg-Gly-Asp tripeptide associated with cellular adhesion and recognition. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700313 Anti-PSG6 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002782 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031850 Rosetta Predictions human pricing
NM_002782 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195976 predicted 500
2 SASI_Hs01_00195978 predicted 339
3 SASI_Hs01_00195977 predicted 819
4 SASI_Hs01_00195979 predicted 705
5 SASI_Hs01_00195980 predicted 816
6 SASI_Hs01_00195981 predicted 305
7 SASI_Hs01_00195982 predicted 703
8 SASI_Hs01_00195983 predicted 614
9 SASI_Hs01_00195984 predicted 865
10 SASI_Hs01_00195985 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126444 predicted 449
2 SASI_Hs01_00126446 predicted 293
3 SASI_Hs01_00126445 predicted 779
4 SASI_Hs01_00126447 predicted 652
5 SASI_Hs01_00126448 predicted 777
6 SASI_Hs01_00126449 predicted 266
7 SASI_Hs01_00126450 predicted 660
8 SASI_Hs01_00126451 predicted 576
9 SASI_Hs01_00126452 predicted 814
10 SASI_Hs01_00126453 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002782
VALIDATED
PSG6 MISSION shRNA Bacterial Glycerol Stock
pregnancy specific beta-1-glycoprotein 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002782.3-846s1c1
Sequence:CCGGGTCGGAACTACACCTACATTTCTCGAGAAATGTAGGTGTAGTTCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002782.3-303s21c1
Sequence:CCGGTACACGGTCAAATTATATATGCTCGAGCATATATAATTTGACCGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002782.3-144s21c1
Sequence:CCGGCCACCACTGCCCAAGTAATAACTCGAGTTATTACTTGGGCAGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002782.3-586s21c1
Sequence:CCGGGTGGTTGCTGAATGGTCAGAACTCGAGTTCTGACCATTCAGCAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002782.3-1255s1c1
Sequence:CCGGCAAGGAAATCTCCAAATCCATCTCGAGATGGATTTGGAGATTTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002782.3-772s1c1
Sequence:CCGGGCCTTACATCACCATCAACAACTCGAGTTGTTGATGGTGATGTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002782.3-270s1c1
Sequence:CCGGCGGACCTCTACCATTACATTACTCGAGTAATGTAATGGTAGAGGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002782.3-449s21c1
Sequence:CCGGGTAACTGGATATTTCACTGTCCTCGAGGACAGTGAAATATCCAGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002782
VALIDATED
PSG6 MISSION shRNA shRNA Plasmid DNA
pregnancy specific beta-1-glycoprotein 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002782.3-846s1c1
Sequence:CCGGGTCGGAACTACACCTACATTTCTCGAGAAATGTAGGTGTAGTTCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002782.3-303s21c1
Sequence:CCGGTACACGGTCAAATTATATATGCTCGAGCATATATAATTTGACCGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002782.3-144s21c1
Sequence:CCGGCCACCACTGCCCAAGTAATAACTCGAGTTATTACTTGGGCAGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002782.3-586s21c1
Sequence:CCGGGTGGTTGCTGAATGGTCAGAACTCGAGTTCTGACCATTCAGCAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002782.3-1255s1c1
Sequence:CCGGCAAGGAAATCTCCAAATCCATCTCGAGATGGATTTGGAGATTTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002782.3-772s1c1
Sequence:CCGGGCCTTACATCACCATCAACAACTCGAGTTGTTGATGGTGATGTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002782.3-270s1c1
Sequence:CCGGCGGACCTCTACCATTACATTACTCGAGTAATGTAATGGTAGAGGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002782.3-449s21c1
Sequence:CCGGGTAACTGGATATTTCACTGTCCTCGAGGACAGTGAAATATCCAGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002782
VALIDATED
PSG6 MISSION shRNA Lentiviral Transduction Particles
pregnancy specific beta-1-glycoprotein 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002782.3-846s1c1
Sequence:CCGGGTCGGAACTACACCTACATTTCTCGAGAAATGTAGGTGTAGTTCCGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002782.3-303s21c1
Sequence:CCGGTACACGGTCAAATTATATATGCTCGAGCATATATAATTTGACCGTGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002782.3-144s21c1
Sequence:CCGGCCACCACTGCCCAAGTAATAACTCGAGTTATTACTTGGGCAGTGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002782.3-586s21c1
Sequence:CCGGGTGGTTGCTGAATGGTCAGAACTCGAGTTCTGACCATTCAGCAACCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002782.3-1255s1c1
Sequence:CCGGCAAGGAAATCTCCAAATCCATCTCGAGATGGATTTGGAGATTTCCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002782.3-772s1c1
Sequence:CCGGGCCTTACATCACCATCAACAACTCGAGTTGTTGATGGTGATGTAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002782.3-270s1c1
Sequence:CCGGCGGACCTCTACCATTACATTACTCGAGTAATGTAATGGTAGAGGTCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002782.3-449s21c1
Sequence:CCGGGTAACTGGATATTTCACTGTCCTCGAGGACAGTGAAATATCCAGTTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)