EMAIL THIS PAGE TO A FRIEND

PSG7

pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)

10 Gene Product Result for
Synonyms: PSBG-7 PSG1 PSGGA
Species: Human PSG7(5676)
UniProtKB ID: Q13046, Q15232
Gene ID:
Human(5676) Summary: This gene is a member of the pregnancy-specific glycoprotein (PSG) gene family. The PSG genes are a subgroup of the carcinoembryonic antigen (CEA) family of immunoglobulin-like genes, and are found in a gene cluster at 19q13.1-q13.2 telomeric to another cluster of CEA-related genes. The PSG genes are expressed by placental trophoblasts and released into the maternal circulation during pregnancy, and are thought to be essential for maintenance of normal pregnancy. The reference genome contains a nonsense mutation that disrupts the coding sequence, suggesting that this gene may be evolving into a pseudogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301254 ANTI-PSG7 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002783 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002783 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027029 predicted 282
2 SASI_Hs01_00027030 predicted 666
3 SASI_Hs01_00027031 predicted 400
4 SASI_Hs01_00027032 predicted 812
5 SASI_Hs01_00027033 predicted 463
6 SASI_Hs01_00027034 predicted 1072
7 SASI_Hs01_00027035 predicted 1200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002783
PSG7 MISSION shRNA Bacterial Glycerol Stock
pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-228s1c1
Sequence:CCGGCCCAGAATCTTACTGGCTACACTCGAGTGTAGCCAGTAAGATTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-775s1c1
Sequence:CCGGGCCCTACATCACCATCAATAACTCGAGTTATTGATGGTGATGTAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002783.1-1824s1c1
Sequence:CCGGGCAGAGAAGATGGTTTCTATACTCGAGTATAGAAACCATCTTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-542s1c1
Sequence:CCGGGCTGTGATCTTAACCTGTGATCTCGAGATCACAGGTTAAGATCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-687s1c1
Sequence:CCGGCAGGACCCTATGAATGTGAAACTCGAGTTTCACATTCATAGGGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-85s1c1
Sequence:CCGGGCATATAACCTGGAAAGGGCTCTCGAGAGCCCTTTCCAGGTTATATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-229s1c1
Sequence:CCGGCCAGAATCTTACTGGCTACATCTCGAGATGTAGCCAGTAAGATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002783
PSG7 MISSION shRNA shRNA Plasmid DNA
pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-228s1c1
Sequence:CCGGCCCAGAATCTTACTGGCTACACTCGAGTGTAGCCAGTAAGATTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-775s1c1
Sequence:CCGGGCCCTACATCACCATCAATAACTCGAGTTATTGATGGTGATGTAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002783.1-1824s1c1
Sequence:CCGGGCAGAGAAGATGGTTTCTATACTCGAGTATAGAAACCATCTTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-542s1c1
Sequence:CCGGGCTGTGATCTTAACCTGTGATCTCGAGATCACAGGTTAAGATCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-687s1c1
Sequence:CCGGCAGGACCCTATGAATGTGAAACTCGAGTTTCACATTCATAGGGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-85s1c1
Sequence:CCGGGCATATAACCTGGAAAGGGCTCTCGAGAGCCCTTTCCAGGTTATATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-229s1c1
Sequence:CCGGCCAGAATCTTACTGGCTACATCTCGAGATGTAGCCAGTAAGATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002783
PSG7 MISSION shRNA Lentiviral Transduction Particles
pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-228s1c1
Sequence:CCGGCCCAGAATCTTACTGGCTACACTCGAGTGTAGCCAGTAAGATTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-775s1c1
Sequence:CCGGGCCCTACATCACCATCAATAACTCGAGTTATTGATGGTGATGTAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002783.1-1824s1c1
Sequence:CCGGGCAGAGAAGATGGTTTCTATACTCGAGTATAGAAACCATCTTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-542s1c1
Sequence:CCGGGCTGTGATCTTAACCTGTGATCTCGAGATCACAGGTTAAGATCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-687s1c1
Sequence:CCGGCAGGACCCTATGAATGTGAAACTCGAGTTTCACATTCATAGGGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-85s1c1
Sequence:CCGGGCATATAACCTGGAAAGGGCTCTCGAGAGCCCTTTCCAGGTTATATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002783.1-229s1c1
Sequence:CCGGCCAGAATCTTACTGGCTACATCTCGAGATGTAGCCAGTAAGATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)