EMAIL THIS PAGE TO A FRIEND

PSIP1

PC4 and SFRS1 interacting protein 1

146 Gene Product Result for
Synonyms: DFS70 LEDGF PAIP PSIP2 p52 p75
Gene ID:
Mouse(101739) PC4 and SFRS1 interacting protein 1
Rat(313323) PC4 and SFRS1 interacting protein 1
Zebrafish(553760) PC4 and SFRS1 interacting protein 1
dog(474712) PC4 and SFRS1 interacting protein 1
Horse(100034217) PC4 and SFRS1 interacting protein 1
domestic cat(493969) PC4 and SFRS1 interacting protein 1
chicken(431605) PC4 and SFRS1 interacting protein 1
domestic guinea pig(100718598) PC4 and SFRS1 interacting protein 1
naked mole-rat(101715852) PC4 and SFRS1 interacting protein 1
Domestic Rabbit(100339871) PC4 and SFRS1 interacting protein 1
cow(282011) PC4 and SFRS1 interacting protein 1
sheep(100233239) PC4 and SFRS1 interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1559 Human LEDGF ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021144 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128217 Rosetta Predictions human pricing
NM_021144 Rosetta Predictions human pricing
NM_033222 Rosetta Predictions human pricing
NM_175765 Rosetta Predictions rat pricing
NM_133948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330906 predicted 556
2 SASI_Hs02_00330907 predicted 1943
3 SASI_Hs02_00330908 predicted 1359
4 SASI_Hs02_00330909 predicted 1464
5 SASI_Hs02_00330910 predicted 1750
6 SASI_Hs02_00330911 predicted 1918
7 SASI_Hs02_00330912 predicted 600
8 SASI_Hs02_00330913 predicted 1444
9 SASI_Hs02_00330914 predicted 637
10 SASI_Hs02_00330915 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200607 predicted 313
2 SASI_Hs02_00354671 predicted 454
3 SASI_Hs02_00354672 predicted 354
4 SASI_Hs01_00200608 predicted 413
5 SASI_Hs01_00200609 predicted 355
6 SASI_Hs01_00200610 predicted 386
7 SASI_Hs01_00200611 predicted 409
8 SASI_Hs01_00200612 predicted 411
9 SASI_Hs01_00200613 predicted 317
10 SASI_Hs01_00200614 predicted 460
11 SASI_Hs01_00200615 predicted 314
12 SASI_Hs01_00200616 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229225 predicted 544
2 SASI_Hs02_00361018 predicted 685
3 SASI_Hs02_00361019 predicted 591
4 SASI_Hs01_00229226 predicted 643
5 SASI_Hs01_00229227 predicted 581
6 SASI_Hs01_00229228 predicted 620
7 SASI_Hs01_00229229 predicted 646
8 SASI_Hs01_00229230 predicted 639
9 SASI_Hs01_00229231 predicted 546
10 SASI_Hs01_00229232 predicted 695
11 SASI_Hs01_00229233 predicted 548
12 SASI_Hs01_00229234 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085710 predicted 500
2 SASI_Rn01_00085711 predicted 1388
3 SASI_Rn01_00085712 predicted 1411
4 SASI_Rn01_00085713 predicted 1553
5 SASI_Rn01_00085714 predicted 1113
6 SASI_Rn02_00269526 predicted 1472
7 SASI_Rn01_00085715 predicted 1335
8 SASI_Rn01_00085716 predicted 1724
9 SASI_Rn01_00085718 predicted 1734
10 SASI_Rn02_00269527 predicted 1543
11 SASI_Rn01_00085717 predicted 411
12 SASI_Rn01_00085719 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120290 predicted 1280
2 SASI_Mm01_00120291 predicted 1270
3 SASI_Mm01_00120292 predicted 597
4 SASI_Mm01_00120293 predicted 535
5 SASI_Mm01_00120294 predicted 1428
6 SASI_Mm02_00339055 predicted 1907
7 SASI_Mm02_00339056 predicted 1548
8 SASI_Mm01_00120295 predicted 1675
9 SASI_Mm01_00120296 predicted 1817
10 SASI_Mm02_00339057 predicted 602
11 SASI_Mm01_00120297 predicted 1382
12 SASI_Mm01_00120298 predicted 1478
13 SASI_Mm01_00120299 predicted 1503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133948
VALIDATED
PSIP1 MISSION shRNA Bacterial Glycerol Stock
PC4 and SFRS1 interacting protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-1468s1c1
Sequence:CCGGCGGTTCAAAGTCAGTCAAGTTCTCGAGAACTTGACTGACTTTGAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-367s1c1
Sequence:CCGGCCCACAAACAAACTACCCATTCTCGAGAATGGGTAGTTTGTTTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-2368s1c1
Sequence:CCGGGCCTCTTTGTAATAATGCGTACTCGAGTACGCATTATTACAAAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-550s1c1
Sequence:CCGGGCATCAACTAAACAATCCAATCTCGAGATTGGATTGTTTAGTTGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-302s1c1
Sequence:CCGGAGATGAAAGGTTATCCTCATTCTCGAGAATGAGGATAACCTTTCATCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133948
VALIDATED
PSIP1 MISSION shRNA shRNA Plasmid DNA
PC4 and SFRS1 interacting protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-1468s1c1
Sequence:CCGGCGGTTCAAAGTCAGTCAAGTTCTCGAGAACTTGACTGACTTTGAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-367s1c1
Sequence:CCGGCCCACAAACAAACTACCCATTCTCGAGAATGGGTAGTTTGTTTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-2368s1c1
Sequence:CCGGGCCTCTTTGTAATAATGCGTACTCGAGTACGCATTATTACAAAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-550s1c1
Sequence:CCGGGCATCAACTAAACAATCCAATCTCGAGATTGGATTGTTTAGTTGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-302s1c1
Sequence:CCGGAGATGAAAGGTTATCCTCATTCTCGAGAATGAGGATAACCTTTCATCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133948
VALIDATED
PSIP1 MISSION shRNA Lentiviral Transduction Particles
PC4 and SFRS1 interacting protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-1468s1c1
Sequence:CCGGCGGTTCAAAGTCAGTCAAGTTCTCGAGAACTTGACTGACTTTGAACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-367s1c1
Sequence:CCGGCCCACAAACAAACTACCCATTCTCGAGAATGGGTAGTTTGTTTGTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-2368s1c1
Sequence:CCGGGCCTCTTTGTAATAATGCGTACTCGAGTACGCATTATTACAAAGAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-550s1c1
Sequence:CCGGGCATCAACTAAACAATCCAATCTCGAGATTGGATTGTTTAGTTGATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133948.2-302s1c1
Sequence:CCGGAGATGAAAGGTTATCCTCATTCTCGAGAATGAGGATAACCTTTCATCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021144
VALIDATED
PSIP1 MISSION shRNA Bacterial Glycerol Stock
PC4 and SFRS1 interacting protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021144.2-366s1c1
Sequence:CCGGGCAGCAACTAAACAATCAAATCTCGAGATTTGATTGTTTAGTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_021144.2-485s1c1
Sequence:CCGGAGTTGACATAACTACTCCAAACTCGAGTTTGGAGTAGTTATGTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021144.2-1513s1c1
Sequence:CCGGGCCCTTCTCTTGACATTCCTTCTCGAGAAGGAATGTCAAGAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021144.3-651s21c1
Sequence:CCGGGCAGCTACAGAAGTCAAGATTCTCGAGAATCTTGACTTCTGTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021144.2-182s1c1
Sequence:CCGGACCCACAAACAAACTACCCATCTCGAGATGGGTAGTTTGTTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021144.2-627s1c1
Sequence:CCGGGCAGCTACAGAAGTCAAGATTCTCGAGAATCTTGACTTCTGTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021144.3-257s21c1
Sequence:CCGGTTTAGGACCAAAGGATATATTCTCGAGAATATATCCTTTGGTCCTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021144.3-390s21c1
Sequence:CCGGGCAGCAACTAAACAATCAAATCTCGAGATTTGATTGTTTAGTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021144.3-1046s21c1
Sequence:CCGGACGCAAGCAAGAGGAACAAATCTCGAGATTTGTTCCTCTTGCTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021144.3-1328s21c1
Sequence:CCGGTACTAAGGTCGGCCATCATTCCTCGAGGAATGATGGCCGACCTTAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021144
VALIDATED
PSIP1 MISSION shRNA shRNA Plasmid DNA
PC4 and SFRS1 interacting protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021144.2-366s1c1
Sequence:CCGGGCAGCAACTAAACAATCAAATCTCGAGATTTGATTGTTTAGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_021144.2-485s1c1
Sequence:CCGGAGTTGACATAACTACTCCAAACTCGAGTTTGGAGTAGTTATGTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021144.2-1513s1c1
Sequence:CCGGGCCCTTCTCTTGACATTCCTTCTCGAGAAGGAATGTCAAGAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021144.3-651s21c1
Sequence:CCGGGCAGCTACAGAAGTCAAGATTCTCGAGAATCTTGACTTCTGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021144.2-182s1c1
Sequence:CCGGACCCACAAACAAACTACCCATCTCGAGATGGGTAGTTTGTTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021144.2-627s1c1
Sequence:CCGGGCAGCTACAGAAGTCAAGATTCTCGAGAATCTTGACTTCTGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021144.3-257s21c1
Sequence:CCGGTTTAGGACCAAAGGATATATTCTCGAGAATATATCCTTTGGTCCTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021144.3-390s21c1
Sequence:CCGGGCAGCAACTAAACAATCAAATCTCGAGATTTGATTGTTTAGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021144.3-1046s21c1
Sequence:CCGGACGCAAGCAAGAGGAACAAATCTCGAGATTTGTTCCTCTTGCTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021144.3-1328s21c1
Sequence:CCGGTACTAAGGTCGGCCATCATTCCTCGAGGAATGATGGCCGACCTTAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021144
VALIDATED
PSIP1 MISSION shRNA Lentiviral Transduction Particles
PC4 and SFRS1 interacting protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021144.2-366s1c1
Sequence:CCGGGCAGCAACTAAACAATCAAATCTCGAGATTTGATTGTTTAGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_021144.2-485s1c1
Sequence:CCGGAGTTGACATAACTACTCCAAACTCGAGTTTGGAGTAGTTATGTCAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021144.2-1513s1c1
Sequence:CCGGGCCCTTCTCTTGACATTCCTTCTCGAGAAGGAATGTCAAGAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021144.3-651s21c1
Sequence:CCGGGCAGCTACAGAAGTCAAGATTCTCGAGAATCTTGACTTCTGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021144.2-182s1c1
Sequence:CCGGACCCACAAACAAACTACCCATCTCGAGATGGGTAGTTTGTTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021144.2-627s1c1
Sequence:CCGGGCAGCTACAGAAGTCAAGATTCTCGAGAATCTTGACTTCTGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021144.3-257s21c1
Sequence:CCGGTTTAGGACCAAAGGATATATTCTCGAGAATATATCCTTTGGTCCTAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021144.3-390s21c1
Sequence:CCGGGCAGCAACTAAACAATCAAATCTCGAGATTTGATTGTTTAGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021144.3-1046s21c1
Sequence:CCGGACGCAAGCAAGAGGAACAAATCTCGAGATTTGTTCCTCTTGCTTGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021144.3-1328s21c1
Sequence:CCGGTACTAAGGTCGGCCATCATTCCTCGAGGAATGATGGCCGACCTTAGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)