EMAIL THIS PAGE TO A FRIEND

PSKH2

protein serine kinase H2

29 Gene Product Result for
UniProtKB ID: Q96QS6, A0AV22
Gene ID:
domestic guinea pig(100718362) protein serine kinase H2
naked mole-rat(101697207) protein serine kinase H2
cow(787436) protein serine kinase H2
sheep(101113079) protein serine kinase H2
dog(487033) protein serine kinase H2
domestic cat(101095152) protein serine kinase H2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033126 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035121 MISSION® esiRNA esiRNA human PSKH2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033126 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200857 predicted 865
2 SASI_Hs01_00200858 predicted 637
3 SASI_Hs01_00200859 predicted 829
4 SASI_Hs01_00200860 predicted 339
5 SASI_Hs01_00200861 predicted 798
6 SASI_Hs01_00200862 predicted 556
7 SASI_Hs01_00200863 predicted 526
8 SASI_Hs02_00360854 predicted 564
9 SASI_Hs01_00200864 predicted 382
10 SASI_Hs01_00200866 predicted 483
11 SASI_Hs01_00200865 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033126
PSKH2 MISSION shRNA Bacterial Glycerol Stock
protein serine kinase H2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-241s1c1
Sequence:CCGGGAGCAGAAGACCACCAAGAAACTCGAGTTTCTTGGTGGTCTTCTGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-340s1c1
Sequence:CCGGCGGGTTAGCCATCGTTACATTCTCGAGAATGTAACGATGGCTAACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-388s1c1
Sequence:CCGGGAGGATCAAGTTTACATGGTACTCGAGTACCATGTAAACTTGATCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-647s1c1
Sequence:CCGGACTGGACAATGAAGACACTCTCTCGAGAGAGTGTCTTCATTGTCCAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-504s1c1
Sequence:CCGGTGATGGGATTAGGTATTTGCACTCGAGTGCAAATACCTAATCCCATCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033126.1-997s1c1
Sequence:CCGGCAGAGGGCCATATCCCGAAACCTCGAGGTTTCGGGATATGGCCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033126.1-177s1c1
Sequence:CCGGCCTTGCCAGGTATGACATCAACTCGAGTTGATGTCATACCTGGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033126.1-541s1c1
Sequence:CCGGCATAGGAATCTAAAGCCTGAACTCGAGTTCAGGCTTTAGATTCCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033126
PSKH2 MISSION shRNA shRNA Plasmid DNA
protein serine kinase H2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-241s1c1
Sequence:CCGGGAGCAGAAGACCACCAAGAAACTCGAGTTTCTTGGTGGTCTTCTGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-340s1c1
Sequence:CCGGCGGGTTAGCCATCGTTACATTCTCGAGAATGTAACGATGGCTAACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-388s1c1
Sequence:CCGGGAGGATCAAGTTTACATGGTACTCGAGTACCATGTAAACTTGATCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-647s1c1
Sequence:CCGGACTGGACAATGAAGACACTCTCTCGAGAGAGTGTCTTCATTGTCCAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-504s1c1
Sequence:CCGGTGATGGGATTAGGTATTTGCACTCGAGTGCAAATACCTAATCCCATCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033126.1-997s1c1
Sequence:CCGGCAGAGGGCCATATCCCGAAACCTCGAGGTTTCGGGATATGGCCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033126.1-177s1c1
Sequence:CCGGCCTTGCCAGGTATGACATCAACTCGAGTTGATGTCATACCTGGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033126.1-541s1c1
Sequence:CCGGCATAGGAATCTAAAGCCTGAACTCGAGTTCAGGCTTTAGATTCCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033126
PSKH2 MISSION shRNA Lentiviral Transduction Particles
protein serine kinase H2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-241s1c1
Sequence:CCGGGAGCAGAAGACCACCAAGAAACTCGAGTTTCTTGGTGGTCTTCTGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-340s1c1
Sequence:CCGGCGGGTTAGCCATCGTTACATTCTCGAGAATGTAACGATGGCTAACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-388s1c1
Sequence:CCGGGAGGATCAAGTTTACATGGTACTCGAGTACCATGTAAACTTGATCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-647s1c1
Sequence:CCGGACTGGACAATGAAGACACTCTCTCGAGAGAGTGTCTTCATTGTCCAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033126.x-504s1c1
Sequence:CCGGTGATGGGATTAGGTATTTGCACTCGAGTGCAAATACCTAATCCCATCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033126.1-997s1c1
Sequence:CCGGCAGAGGGCCATATCCCGAAACCTCGAGGTTTCGGGATATGGCCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033126.1-177s1c1
Sequence:CCGGCCTTGCCAGGTATGACATCAACTCGAGTTGATGTCATACCTGGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033126.1-541s1c1
Sequence:CCGGCATAGGAATCTAAAGCCTGAACTCGAGTTCAGGCTTTAGATTCCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)