EMAIL THIS PAGE TO A FRIEND

PSMA1

proteasome (prosome, macropain) subunit, alpha type, 1

98 Gene Product Result for
Synonyms: HC2 NU PROS30
UniProtKB ID: P25786, A8K400, Q53YE8, Q9BRV9
Gene ID:
Human(5682) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Mouse(26440) proteasome (prosome, macropain) subunit, alpha type 1
Rat(29668) proteasome (prosome, macropain) subunit, alpha type 1
Zebrafish(445033) proteasome (prosome, macropain) subunit, alpha type, 1
Horse(100056224) proteasome (prosome, macropain) subunit, alpha type, 1
chicken(395874) proteasome (prosome, macropain) subunit, alpha type, 1
dog(476867) proteasome (prosome, macropain) subunit, alpha type, 1
domestic cat(101093640) proteasome (prosome, macropain) subunit, alpha type, 1
cow(515503) proteasome (prosome, macropain) subunit, alpha type, 1
sheep(101118048) proteasome (prosome, macropain) subunit, alpha type, 1
naked mole-rat(101724081) proteasome (prosome, macropain) subunit, alpha type, 1
domestic guinea pig(100731270) proteasome (prosome, macropain) subunit, alpha type, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100614 Anti-PSMA1 (11-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100615 Anti-PSMA1 (116-130) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW22044A Anti-PSMA1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
AV40417 Anti-PSMA1 antibody produced in rabbit affinity isolated antibody human, rat, bovine, rabbit, horse, guinea pig, zebrafish, mouse, canine
immunohistochemistry, western blot pricing
AV40418 Anti-PSMA1 antibody produced in rabbit IgG fraction of antiserum rat, rabbit, mouse, guinea pig, horse, canine, human, bovine
western blot pricing
HPA043891 Anti-PSMA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA037646 Anti-PSMA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
WH0005682M1 Monoclonal Anti-PSMA1 antibody produced in mouse clone 1D9-1C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404263 Monoclonal Anti-PSMA1 antibody produced in mouse clone 3F12-2C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011965 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011965 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011965 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002786 Rosetta Predictions human pricing
NM_148976 Rosetta Predictions human pricing
NM_017278 Rosetta Predictions rat pricing
NM_011965 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334422 predicted 629
2 SASI_Hs01_00011096 predicted 448
3 SASI_Hs01_00011097 predicted 599
4 SASI_Hs01_00011098 predicted 497
5 SASI_Hs01_00011099 predicted 713
6 SASI_Hs02_00334423 predicted 613
7 SASI_Hs01_00011100 predicted 896
8 SASI_Hs01_00011101 predicted 739
9 SASI_Hs01_00011102 predicted 616
10 SASI_Hs01_00011103 predicted 482
11 SASI_Hs01_00011104 predicted 615
12 SASI_Hs01_00011105 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365691 predicted 868
2 SASI_Hs01_00176930 predicted 693
3 SASI_Hs01_00176931 predicted 844
4 SASI_Hs01_00176932 predicted 732
5 SASI_Hs01_00176933 predicted 948
6 SASI_Hs02_00365692 predicted 855
7 SASI_Hs01_00176934 predicted 1142
8 SASI_Hs01_00176935 predicted 985
9 SASI_Hs01_00176936 predicted 865
10 SASI_Hs01_00176937 predicted 724
11 SASI_Hs01_00176938 predicted 859
12 SASI_Hs01_00176939 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087928 predicted 733
2 SASI_Rn01_00087929 predicted 436
3 SASI_Rn01_00087930 predicted 614
4 SASI_Rn01_00087931 predicted 915
5 SASI_Rn01_00087932 predicted 590
6 SASI_Rn01_00087933 predicted 355
7 SASI_Rn01_00087934 predicted 482
8 SASI_Rn01_00087935 predicted 311
9 SASI_Rn01_00087936 predicted 332
10 SASI_Rn02_00261686 predicted 869
11 SASI_Rn01_00087937 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011965 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074642 predicted 626
2 SASI_Mm01_00074644 predicted 938
3 SASI_Mm01_00074645 predicted 477
4 SASI_Mm01_00074646 predicted 515
5 SASI_Mm01_00074647 predicted 641
6 SASI_Mm01_00074648 predicted 502
7 SASI_Mm02_00321849 predicted 362
8 SASI_Mm01_00074649 predicted 626
9 SASI_Mm01_00074650 predicted 727
10 SASI_Mm01_00074651 predicted 591
11 SASI_Mm01_00074643 predicted 766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002786
VALIDATED
PSMA1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002786.x-176s1c1
Sequence:CCGGGCAATGGAAGCTGTTAAACAACTCGAGTTGTTTAACAGCTTCCATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002786.x-336s1c1
Sequence:CCGGCTGCTGATGCTAGACTGTTATCTCGAGATAACAGTCTAGCATCAGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002786.x-594s1c1
Sequence:CCGGGTTCCCAATCAGCTCGTACTTCTCGAGAAGTACGAGCTGATTGGGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002786.x-451s1c1
Sequence:CCGGCCAGATACCAACACAACGATACTCGAGTATCGTTGTGTTGGTATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002786.2-176s21c1
Sequence:CCGGGCAATGGAAGCTGTTAAACAACTCGAGTTGTTTAACAGCTTCCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002786.2-451s21c1
Sequence:CCGGCCAGATACCAACACAACGATACTCGAGTATCGTTGTGTTGGTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002786.2-1086s21c1
Sequence:CCGGGAAAGGGTCTGTATAATCATTCTCGAGAATGATTATACAGACCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002786.2-336s21c1
Sequence:CCGGCTGCTGATGCTAGACTGTTATCTCGAGATAACAGTCTAGCATCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002786.2-594s21c1
Sequence:CCGGGTTCCCAATCAGCTCGTACTTCTCGAGAAGTACGAGCTGATTGGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002786
VALIDATED
PSMA1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002786.x-176s1c1
Sequence:CCGGGCAATGGAAGCTGTTAAACAACTCGAGTTGTTTAACAGCTTCCATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002786.x-336s1c1
Sequence:CCGGCTGCTGATGCTAGACTGTTATCTCGAGATAACAGTCTAGCATCAGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002786.x-594s1c1
Sequence:CCGGGTTCCCAATCAGCTCGTACTTCTCGAGAAGTACGAGCTGATTGGGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002786.x-451s1c1
Sequence:CCGGCCAGATACCAACACAACGATACTCGAGTATCGTTGTGTTGGTATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002786.2-176s21c1
Sequence:CCGGGCAATGGAAGCTGTTAAACAACTCGAGTTGTTTAACAGCTTCCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002786.2-451s21c1
Sequence:CCGGCCAGATACCAACACAACGATACTCGAGTATCGTTGTGTTGGTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002786.2-1086s21c1
Sequence:CCGGGAAAGGGTCTGTATAATCATTCTCGAGAATGATTATACAGACCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002786.2-336s21c1
Sequence:CCGGCTGCTGATGCTAGACTGTTATCTCGAGATAACAGTCTAGCATCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002786.2-594s21c1
Sequence:CCGGGTTCCCAATCAGCTCGTACTTCTCGAGAAGTACGAGCTGATTGGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002786
VALIDATED
PSMA1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002786.x-176s1c1
Sequence:CCGGGCAATGGAAGCTGTTAAACAACTCGAGTTGTTTAACAGCTTCCATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002786.x-336s1c1
Sequence:CCGGCTGCTGATGCTAGACTGTTATCTCGAGATAACAGTCTAGCATCAGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002786.x-594s1c1
Sequence:CCGGGTTCCCAATCAGCTCGTACTTCTCGAGAAGTACGAGCTGATTGGGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002786.x-451s1c1
Sequence:CCGGCCAGATACCAACACAACGATACTCGAGTATCGTTGTGTTGGTATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002786.2-176s21c1
Sequence:CCGGGCAATGGAAGCTGTTAAACAACTCGAGTTGTTTAACAGCTTCCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002786.2-451s21c1
Sequence:CCGGCCAGATACCAACACAACGATACTCGAGTATCGTTGTGTTGGTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002786.2-1086s21c1
Sequence:CCGGGAAAGGGTCTGTATAATCATTCTCGAGAATGATTATACAGACCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002786.2-336s21c1
Sequence:CCGGCTGCTGATGCTAGACTGTTATCTCGAGATAACAGTCTAGCATCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002786.2-594s21c1
Sequence:CCGGGTTCCCAATCAGCTCGTACTTCTCGAGAAGTACGAGCTGATTGGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011965
VALIDATED
PSMA1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-641s1c1
Sequence:CCGGGCAATTTGGATGAACTGGTTACTCGAGTAACCAGTTCATCCAAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-601s1c1
Sequence:CCGGCGTACTTACCTGGAGAGACATCTCGAGATGTCTCTCCAGGTAAGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-191s1c1
Sequence:CCGGGTTCAGCAACAGTTGGTCTAACTCGAGTTAGACCAACTGTTGCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-866s1c1
Sequence:CCGGCCGATGAACCAATGGAACATTCTCGAGAATGTTCCATTGGTTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-421s1c1
Sequence:CCGGGTGTCTCTAATTGGAAGCAAACTCGAGTTTGCTTCCAATTAGAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011965.2-658s21c1
Sequence:CCGGGCAATTTGGATGAACTGGTTACTCGAGTAACCAGTTCATCCAAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011965.2-618s21c1
Sequence:CCGGCGTACTTACCTGGAGAGACATCTCGAGATGTCTCTCCAGGTAAGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011965.2-883s21c1
Sequence:CCGGCCGATGAACCAATGGAACATTCTCGAGAATGTTCCATTGGTTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011965.2-208s21c1
Sequence:CCGGGTTCAGCAACAGTTGGTCTAACTCGAGTTAGACCAACTGTTGCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011965
VALIDATED
PSMA1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-641s1c1
Sequence:CCGGGCAATTTGGATGAACTGGTTACTCGAGTAACCAGTTCATCCAAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-601s1c1
Sequence:CCGGCGTACTTACCTGGAGAGACATCTCGAGATGTCTCTCCAGGTAAGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-191s1c1
Sequence:CCGGGTTCAGCAACAGTTGGTCTAACTCGAGTTAGACCAACTGTTGCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-866s1c1
Sequence:CCGGCCGATGAACCAATGGAACATTCTCGAGAATGTTCCATTGGTTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-421s1c1
Sequence:CCGGGTGTCTCTAATTGGAAGCAAACTCGAGTTTGCTTCCAATTAGAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011965.2-658s21c1
Sequence:CCGGGCAATTTGGATGAACTGGTTACTCGAGTAACCAGTTCATCCAAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011965.2-618s21c1
Sequence:CCGGCGTACTTACCTGGAGAGACATCTCGAGATGTCTCTCCAGGTAAGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011965.2-883s21c1
Sequence:CCGGCCGATGAACCAATGGAACATTCTCGAGAATGTTCCATTGGTTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011965.2-208s21c1
Sequence:CCGGGTTCAGCAACAGTTGGTCTAACTCGAGTTAGACCAACTGTTGCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011965
VALIDATED
PSMA1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-641s1c1
Sequence:CCGGGCAATTTGGATGAACTGGTTACTCGAGTAACCAGTTCATCCAAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-601s1c1
Sequence:CCGGCGTACTTACCTGGAGAGACATCTCGAGATGTCTCTCCAGGTAAGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-191s1c1
Sequence:CCGGGTTCAGCAACAGTTGGTCTAACTCGAGTTAGACCAACTGTTGCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-866s1c1
Sequence:CCGGCCGATGAACCAATGGAACATTCTCGAGAATGTTCCATTGGTTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011965.1-421s1c1
Sequence:CCGGGTGTCTCTAATTGGAAGCAAACTCGAGTTTGCTTCCAATTAGAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011965.2-658s21c1
Sequence:CCGGGCAATTTGGATGAACTGGTTACTCGAGTAACCAGTTCATCCAAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011965.2-618s21c1
Sequence:CCGGCGTACTTACCTGGAGAGACATCTCGAGATGTCTCTCCAGGTAAGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011965.2-883s21c1
Sequence:CCGGCCGATGAACCAATGGAACATTCTCGAGAATGTTCCATTGGTTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011965.2-208s21c1
Sequence:CCGGGTTCAGCAACAGTTGGTCTAACTCGAGTTAGACCAACTGTTGCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)