EMAIL THIS PAGE TO A FRIEND

PSMA2

proteasome (prosome, macropain) subunit, alpha type, 2

56 Gene Product Result for
Synonyms: HC3 MU PMSA2 PSC2
UniProtKB ID: P25787, Q6ICS6, Q9BU45
Gene ID:
Human(5683) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. [provided by RefSeq, Jul 2008]
Mouse(19166) proteasome (prosome, macropain) subunit, alpha type 2
Rat(29669) proteasome (prosome, macropain) subunit, alpha type 2
domestic guinea pig(100719786) proteasome (prosome, macropain) subunit, alpha type, 2
naked mole-rat(101702709) proteasome (prosome, macropain) subunit, alpha type, 2
cow(539141) proteasome (prosome, macropain) subunit, alpha type, 2
sheep(101119978) proteasome (prosome, macropain) subunit, alpha type, 2
Zebrafish(554153) proteasome (prosome, macropain) subunit, alpha type, 2
domestic cat(101088226) proteasome (prosome, macropain) subunit, alpha type, 2
dog(475870) proteasome (prosome, macropain) subunit, alpha type, 2
chicken(420772) proteasome (prosome, macropain) subunit, alpha type, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA008188 Anti-PSMA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation rat, human, mouse
immunohistochemistry, western blot pricing
SAB2101893 Anti-PSMA2 antibody produced in rabbit affinity isolated antibody dog, mouse, sheep, rat, human, guinea pig, rabbit, horse, bovine
western blot pricing
SAB2700833 Anti-PSMA2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002787 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002787 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002787 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002787 Rosetta Predictions human pricing
NM_017279 Rosetta Predictions rat pricing
NM_008944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146476 predicted 384
2 SASI_Hs01_00146478 predicted 201
3 SASI_Hs01_00146480 predicted 208
4 SASI_Hs01_00146482 predicted 704
5 SASI_Hs01_00146483 predicted 588
6 SASI_Hs01_00146484 predicted 252
7 SASI_Hs02_00334424 predicted 619
8 SASI_Hs02_00334425 predicted 644
9 SASI_Hs02_00334426 predicted 228
10 SASI_Hs02_00334427 predicted 326
11 SASI_Hs01_00146477 predicted 789
12 SASI_Hs01_00146479 predicted 781
13 SASI_Hs01_00146481 predicted 776
14 SASI_Hs01_00146485 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050593 predicted 561
2 SASI_Rn01_00050594 predicted 418
3 SASI_Rn01_00050595 predicted 419
4 SASI_Rn01_00050596 predicted 528
5 SASI_Rn01_00050597 predicted 270
6 SASI_Rn01_00050598 predicted 335
7 SASI_Rn02_00261687 predicted 444
8 SASI_Rn02_00261688 predicted 426
9 SASI_Rn01_00050600 predicted 370
10 SASI_Rn02_00261689 predicted 609
11 SASI_Rn01_00050599 predicted 352
12 SASI_Rn01_00050601 predicted 356
13 SASI_Rn01_00050602 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096013 predicted 238
2 SASI_Mm01_00096014 predicted 410
3 SASI_Mm01_00096015 predicted 402
4 SASI_Mm01_00096016 predicted 313
5 SASI_Mm01_00096017 predicted 370
6 SASI_Mm01_00096018 predicted 418
7 SASI_Mm01_00096019 predicted 362
8 SASI_Mm02_00314994 predicted 628
9 SASI_Mm01_00096010 predicted 393
10 SASI_Mm02_00314995 predicted 453
11 SASI_Mm01_00096011 predicted 344
12 SASI_Mm01_00096012 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002787
VALIDATED
PSMA2 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002787.x-516s1c1
Sequence:CCGGACTATGTGAATGGGAAGACTTCTCGAGAAGTCTTCCCATTCACATAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002787.x-185s1c1
Sequence:CCGGCTGTATGATGAGCGAAGTGTACTCGAGTACACTTCGCTCATCATACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002787.x-619s1c1
Sequence:CCGGAGGGCAAATGACAGAGGATAACTCGAGTTATCCTCTGTCATTTGCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002787.x-579s1c1
Sequence:CCGGCCATTCATACAGCCATCTTAACTCGAGTTAAGATGGCTGTATGAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002787.x-214s1c1
Sequence:CCGGAGAACCAATTACCAAGCATATCTCGAGATATGCTTGGTAATTGGTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-608s21c1
Sequence:CCGGCCATTCATACAGCCATCTTAACTCGAGTTAAGATGGCTGTATGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-243s21c1
Sequence:CCGGAGAACCAATTACCAAGCATATCTCGAGATATGCTTGGTAATTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-545s21c1
Sequence:CCGGACTATGTGAATGGGAAGACTTCTCGAGAAGTCTTCCCATTCACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-648s21c1
Sequence:CCGGAGGGCAAATGACAGAGGATAACTCGAGTTATCCTCTGTCATTTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-214s21c1
Sequence:CCGGCTGTATGATGAGCGAAGTGTACTCGAGTACACTTCGCTCATCATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002787
VALIDATED
PSMA2 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002787.x-516s1c1
Sequence:CCGGACTATGTGAATGGGAAGACTTCTCGAGAAGTCTTCCCATTCACATAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002787.x-185s1c1
Sequence:CCGGCTGTATGATGAGCGAAGTGTACTCGAGTACACTTCGCTCATCATACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002787.x-619s1c1
Sequence:CCGGAGGGCAAATGACAGAGGATAACTCGAGTTATCCTCTGTCATTTGCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002787.x-579s1c1
Sequence:CCGGCCATTCATACAGCCATCTTAACTCGAGTTAAGATGGCTGTATGAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002787.x-214s1c1
Sequence:CCGGAGAACCAATTACCAAGCATATCTCGAGATATGCTTGGTAATTGGTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-608s21c1
Sequence:CCGGCCATTCATACAGCCATCTTAACTCGAGTTAAGATGGCTGTATGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-243s21c1
Sequence:CCGGAGAACCAATTACCAAGCATATCTCGAGATATGCTTGGTAATTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-545s21c1
Sequence:CCGGACTATGTGAATGGGAAGACTTCTCGAGAAGTCTTCCCATTCACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-648s21c1
Sequence:CCGGAGGGCAAATGACAGAGGATAACTCGAGTTATCCTCTGTCATTTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-214s21c1
Sequence:CCGGCTGTATGATGAGCGAAGTGTACTCGAGTACACTTCGCTCATCATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002787
VALIDATED
PSMA2 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002787.x-516s1c1
Sequence:CCGGACTATGTGAATGGGAAGACTTCTCGAGAAGTCTTCCCATTCACATAGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002787.x-185s1c1
Sequence:CCGGCTGTATGATGAGCGAAGTGTACTCGAGTACACTTCGCTCATCATACAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002787.x-619s1c1
Sequence:CCGGAGGGCAAATGACAGAGGATAACTCGAGTTATCCTCTGTCATTTGCCCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002787.x-579s1c1
Sequence:CCGGCCATTCATACAGCCATCTTAACTCGAGTTAAGATGGCTGTATGAATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002787.x-214s1c1
Sequence:CCGGAGAACCAATTACCAAGCATATCTCGAGATATGCTTGGTAATTGGTTCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-608s21c1
Sequence:CCGGCCATTCATACAGCCATCTTAACTCGAGTTAAGATGGCTGTATGAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-243s21c1
Sequence:CCGGAGAACCAATTACCAAGCATATCTCGAGATATGCTTGGTAATTGGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-545s21c1
Sequence:CCGGACTATGTGAATGGGAAGACTTCTCGAGAAGTCTTCCCATTCACATAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-648s21c1
Sequence:CCGGAGGGCAAATGACAGAGGATAACTCGAGTTATCCTCTGTCATTTGCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002787.4-214s21c1
Sequence:CCGGCTGTATGATGAGCGAAGTGTACTCGAGTACACTTCGCTCATCATACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008944
PSMA2 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-459s1c1
Sequence:CCGGCGTCCATTTGGTGTTTCTTTACTCGAGTAAAGAAACACCAAATGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-206s1c1
Sequence:CCGGCGTAGTATTAGCAACCGAGAACTCGAGTTCTCGGTTGCTAATACTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-333s1c1
Sequence:CCGGCTTGTACACAGAGCTCGGAAACTCGAGTTTCCGAGCTCTGTGTACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-277s1c1
Sequence:CCGGCCATTACCAAGCACATCGGTTCTCGAGAACCGATGTGCTTGGTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-357s1c1
Sequence:CCGGGCTCAGCAATACTACCTTGTTCTCGAGAACAAGGTAGTATTGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008944.2-313s21c1
Sequence:CCGGGCTCAGCAATACTACCTTGTTCTCGAGAACAAGGTAGTATTGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008944.2-415s21c1
Sequence:CCGGCGTCCATTTGGTGTTTCTTTACTCGAGTAAAGAAACACCAAATGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008944.2-162s21c1
Sequence:CCGGCGTAGTATTAGCAACCGAGAACTCGAGTTCTCGGTTGCTAATACTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008944.2-289s21c1
Sequence:CCGGCTTGTACACAGAGCTCGGAAACTCGAGTTTCCGAGCTCTGTGTACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008944
PSMA2 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-459s1c1
Sequence:CCGGCGTCCATTTGGTGTTTCTTTACTCGAGTAAAGAAACACCAAATGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-206s1c1
Sequence:CCGGCGTAGTATTAGCAACCGAGAACTCGAGTTCTCGGTTGCTAATACTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-333s1c1
Sequence:CCGGCTTGTACACAGAGCTCGGAAACTCGAGTTTCCGAGCTCTGTGTACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-277s1c1
Sequence:CCGGCCATTACCAAGCACATCGGTTCTCGAGAACCGATGTGCTTGGTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-357s1c1
Sequence:CCGGGCTCAGCAATACTACCTTGTTCTCGAGAACAAGGTAGTATTGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008944.2-313s21c1
Sequence:CCGGGCTCAGCAATACTACCTTGTTCTCGAGAACAAGGTAGTATTGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008944.2-415s21c1
Sequence:CCGGCGTCCATTTGGTGTTTCTTTACTCGAGTAAAGAAACACCAAATGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008944.2-162s21c1
Sequence:CCGGCGTAGTATTAGCAACCGAGAACTCGAGTTCTCGGTTGCTAATACTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008944.2-289s21c1
Sequence:CCGGCTTGTACACAGAGCTCGGAAACTCGAGTTTCCGAGCTCTGTGTACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008944
PSMA2 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-459s1c1
Sequence:CCGGCGTCCATTTGGTGTTTCTTTACTCGAGTAAAGAAACACCAAATGGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-206s1c1
Sequence:CCGGCGTAGTATTAGCAACCGAGAACTCGAGTTCTCGGTTGCTAATACTACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-333s1c1
Sequence:CCGGCTTGTACACAGAGCTCGGAAACTCGAGTTTCCGAGCTCTGTGTACAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-277s1c1
Sequence:CCGGCCATTACCAAGCACATCGGTTCTCGAGAACCGATGTGCTTGGTAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008944.1-357s1c1
Sequence:CCGGGCTCAGCAATACTACCTTGTTCTCGAGAACAAGGTAGTATTGCTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008944.2-313s21c1
Sequence:CCGGGCTCAGCAATACTACCTTGTTCTCGAGAACAAGGTAGTATTGCTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008944.2-415s21c1
Sequence:CCGGCGTCCATTTGGTGTTTCTTTACTCGAGTAAAGAAACACCAAATGGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008944.2-162s21c1
Sequence:CCGGCGTAGTATTAGCAACCGAGAACTCGAGTTCTCGGTTGCTAATACTACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008944.2-289s21c1
Sequence:CCGGCTTGTACACAGAGCTCGGAAACTCGAGTTTCCGAGCTCTGTGTACAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)