EMAIL THIS PAGE TO A FRIEND

PSMA3

proteasome (prosome, macropain) subunit, alpha type, 3

70 Gene Product Result for
Synonyms: HC8 PSC3
UniProtKB ID: P25788, B2RCK6, Q86U83, Q8N1D8, Q9BS70
Gene ID:
Human(5684) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Two alternative transcripts encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(19167) proteasome (prosome, macropain) subunit, alpha type 3
Rat(29670) proteasome (prosome, macropain) subunit, alpha type 3
Zebrafish(564370) proteasome (prosome, macropain) subunit, alpha type, 3
dog(480338) proteasome (prosome, macropain) subunit, alpha type, 3
domestic cat(101097403) proteasome (prosome, macropain) subunit, alpha type, 3
chicken(423542) proteasome (prosome, macropain) subunit, alpha type, 3
cow(505176) proteasome (prosome, macropain) subunit, alpha type, 3
sheep(100381249) proteasome (prosome, macropain) subunit, alpha type, 3
naked mole-rat(101704566) proteasome (prosome, macropain) subunit, alpha type, 3
domestic guinea pig(100736221) proteasome (prosome, macropain) subunit, alpha type, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504316 Anti-phospho-Proteasome α3 (pSer250) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
HPA000905 Anti-PSMA3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103136 Anti-PSMA3 antibody produced in rabbit affinity isolated antibody horse, canine, rat, rabbit, guinea pig, human, bovine, mouse
western blot pricing
SAB2103137 Anti-PSMA3 antibody produced in rabbit affinity isolated antibody rat, rabbit, pig, bovine, zebrafish, horse, guinea pig, mouse, human, canine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002788 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002788 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002788 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002788 Rosetta Predictions human pricing
NM_152132 Rosetta Predictions human pricing
NM_017280 Rosetta Predictions rat pricing
NM_011184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188271 predicted 352
2 SASI_Hs01_00188272 predicted 555
3 SASI_Hs01_00188273 predicted 287
4 SASI_Hs01_00188275 predicted 328
5 SASI_Hs01_00188276 predicted 593
6 SASI_Hs01_00188277 predicted 633
7 SASI_Hs01_00188278 predicted 320
8 SASI_Hs01_00188279 predicted 560
9 SASI_Hs02_00334428 predicted 654
10 SASI_Hs02_00334429 predicted 389
11 SASI_Hs01_00188274 predicted 397
12 SASI_Hs01_00188280 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132084 predicted 348
2 SASI_Hs01_00132085 predicted 530
3 SASI_Hs01_00132086 predicted 286
4 SASI_Hs01_00132088 predicted 325
5 SASI_Hs01_00132089 predicted 569
6 SASI_Hs01_00132090 predicted 619
7 SASI_Hs01_00132091 predicted 319
8 SASI_Hs01_00132092 predicted 541
9 SASI_Hs02_00365697 predicted 627
10 SASI_Hs02_00365698 predicted 385
11 SASI_Hs01_00132087 predicted 401
12 SASI_Hs01_00132093 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261690 predicted 548
2 SASI_Rn02_00261691 predicted 633
3 SASI_Rn02_00261692 predicted 362
4 SASI_Rn02_00261693 predicted 638
5 SASI_Rn02_00261694 predicted 549
6 SASI_Rn02_00261695 predicted 603
7 SASI_Rn02_00261696 predicted 432
8 SASI_Rn02_00261697 predicted 604
9 SASI_Rn02_00261698 predicted 359
10 SASI_Rn02_00261699 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141516 predicted 833
2 SASI_Mm01_00141517 predicted 780
3 SASI_Mm01_00141518 predicted 723
4 SASI_Mm01_00141519 predicted 599
5 SASI_Mm01_00141514 predicted 914
6 SASI_Mm01_00141522 predicted 846
7 SASI_Mm02_00320073 predicted 559
8 SASI_Mm02_00320074 predicted 612
9 SASI_Mm02_00320075 predicted 776
10 SASI_Mm02_00320076 predicted 166
11 SASI_Mm01_00141515 predicted 403
12 SASI_Mm01_00141520 predicted 336
13 SASI_Mm01_00141521 predicted 360
14 SASI_Mm01_00141523 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002788
VALIDATED
PSMA3 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002788.x-557s1c1
Sequence:CCGGCAAGCTGCAAAGACGGAAATACTCGAGTATTTCCGTCTTTGCAGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002788.x-595s1c1
Sequence:CCGGAGAAATGACCTGCCGTGATATCTCGAGATATCACGGCAGGTCATTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002788.x-647s1c1
Sequence:CCGGGTACATGACGAAGTTAAGGATCTCGAGATCCTTAACTTCGTCATGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002788.x-507s1c1
Sequence:CCGGCATCAGGTGTTTCATACGGTTCTCGAGAACCGTATGAAACACCTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002788.2-647s21c1
Sequence:CCGGGTACATGACGAAGTTAAGGATCTCGAGATCCTTAACTTCGTCATGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002788.2-557s21c1
Sequence:CCGGCAAGCTGCAAAGACGGAAATACTCGAGTATTTCCGTCTTTGCAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002788.2-507s21c1
Sequence:CCGGCATCAGGTGTTTCATACGGTTCTCGAGAACCGTATGAAACACCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002788.2-595s21c1
Sequence:CCGGAGAAATGACCTGCCGTGATATCTCGAGATATCACGGCAGGTCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002788
VALIDATED
PSMA3 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002788.x-557s1c1
Sequence:CCGGCAAGCTGCAAAGACGGAAATACTCGAGTATTTCCGTCTTTGCAGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002788.x-595s1c1
Sequence:CCGGAGAAATGACCTGCCGTGATATCTCGAGATATCACGGCAGGTCATTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002788.x-647s1c1
Sequence:CCGGGTACATGACGAAGTTAAGGATCTCGAGATCCTTAACTTCGTCATGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002788.x-507s1c1
Sequence:CCGGCATCAGGTGTTTCATACGGTTCTCGAGAACCGTATGAAACACCTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002788.2-647s21c1
Sequence:CCGGGTACATGACGAAGTTAAGGATCTCGAGATCCTTAACTTCGTCATGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002788.2-557s21c1
Sequence:CCGGCAAGCTGCAAAGACGGAAATACTCGAGTATTTCCGTCTTTGCAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002788.2-507s21c1
Sequence:CCGGCATCAGGTGTTTCATACGGTTCTCGAGAACCGTATGAAACACCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002788.2-595s21c1
Sequence:CCGGAGAAATGACCTGCCGTGATATCTCGAGATATCACGGCAGGTCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002788
VALIDATED
PSMA3 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002788.x-557s1c1
Sequence:CCGGCAAGCTGCAAAGACGGAAATACTCGAGTATTTCCGTCTTTGCAGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002788.x-595s1c1
Sequence:CCGGAGAAATGACCTGCCGTGATATCTCGAGATATCACGGCAGGTCATTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002788.x-647s1c1
Sequence:CCGGGTACATGACGAAGTTAAGGATCTCGAGATCCTTAACTTCGTCATGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002788.x-507s1c1
Sequence:CCGGCATCAGGTGTTTCATACGGTTCTCGAGAACCGTATGAAACACCTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002788.2-647s21c1
Sequence:CCGGGTACATGACGAAGTTAAGGATCTCGAGATCCTTAACTTCGTCATGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002788.2-557s21c1
Sequence:CCGGCAAGCTGCAAAGACGGAAATACTCGAGTATTTCCGTCTTTGCAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002788.2-507s21c1
Sequence:CCGGCATCAGGTGTTTCATACGGTTCTCGAGAACCGTATGAAACACCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002788.2-595s21c1
Sequence:CCGGAGAAATGACCTGCCGTGATATCTCGAGATATCACGGCAGGTCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011184
VALIDATED
PSMA3 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011184.2-364s1c1
Sequence:CCGGCGGCTATAACATTCCTCTAAACTCGAGTTTAGAGGAATGTTATAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011184.2-308s1c1
Sequence:CCGGGCTCGTTCATTAGCAGACATACTCGAGTATGTCTGCTAATGAACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011184.2-121s1c1
Sequence:CCGGCCAAGTTGAATATGCCATGAACTCGAGTTCATGGCATATTCAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011184.2-617s1c1
Sequence:CCGGCGTGATGTAGTTAAAGAAGTTCTCGAGAACTTCTTTAACTACATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011184.2-761s1c1
Sequence:CCGGGCAGAGAAATATGCCAAGGAACTCGAGTTCCTTGGCATATTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-363s21c1
Sequence:CCGGCGGCTATAACATTCCTCTAAACTCGAGTTTAGAGGAATGTTATAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-616s21c1
Sequence:CCGGCGTGATGTAGTTAAAGAAGTTCTCGAGAACTTCTTTAACTACATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-120s21c1
Sequence:CCGGCCAAGTTGAATATGCCATGAACTCGAGTTCATGGCATATTCAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-307s21c1
Sequence:CCGGGCTCGTTCATTAGCAGACATACTCGAGTATGTCTGCTAATGAACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-760s21c1
Sequence:CCGGGCAGAGAAATATGCCAAGGAACTCGAGTTCCTTGGCATATTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011184
VALIDATED
PSMA3 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011184.2-364s1c1
Sequence:CCGGCGGCTATAACATTCCTCTAAACTCGAGTTTAGAGGAATGTTATAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011184.2-308s1c1
Sequence:CCGGGCTCGTTCATTAGCAGACATACTCGAGTATGTCTGCTAATGAACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011184.2-121s1c1
Sequence:CCGGCCAAGTTGAATATGCCATGAACTCGAGTTCATGGCATATTCAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011184.2-617s1c1
Sequence:CCGGCGTGATGTAGTTAAAGAAGTTCTCGAGAACTTCTTTAACTACATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011184.2-761s1c1
Sequence:CCGGGCAGAGAAATATGCCAAGGAACTCGAGTTCCTTGGCATATTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-363s21c1
Sequence:CCGGCGGCTATAACATTCCTCTAAACTCGAGTTTAGAGGAATGTTATAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-616s21c1
Sequence:CCGGCGTGATGTAGTTAAAGAAGTTCTCGAGAACTTCTTTAACTACATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-120s21c1
Sequence:CCGGCCAAGTTGAATATGCCATGAACTCGAGTTCATGGCATATTCAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-307s21c1
Sequence:CCGGGCTCGTTCATTAGCAGACATACTCGAGTATGTCTGCTAATGAACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-760s21c1
Sequence:CCGGGCAGAGAAATATGCCAAGGAACTCGAGTTCCTTGGCATATTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011184
VALIDATED
PSMA3 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011184.2-364s1c1
Sequence:CCGGCGGCTATAACATTCCTCTAAACTCGAGTTTAGAGGAATGTTATAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011184.2-308s1c1
Sequence:CCGGGCTCGTTCATTAGCAGACATACTCGAGTATGTCTGCTAATGAACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011184.2-121s1c1
Sequence:CCGGCCAAGTTGAATATGCCATGAACTCGAGTTCATGGCATATTCAACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011184.2-617s1c1
Sequence:CCGGCGTGATGTAGTTAAAGAAGTTCTCGAGAACTTCTTTAACTACATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011184.2-761s1c1
Sequence:CCGGGCAGAGAAATATGCCAAGGAACTCGAGTTCCTTGGCATATTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-363s21c1
Sequence:CCGGCGGCTATAACATTCCTCTAAACTCGAGTTTAGAGGAATGTTATAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-616s21c1
Sequence:CCGGCGTGATGTAGTTAAAGAAGTTCTCGAGAACTTCTTTAACTACATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-120s21c1
Sequence:CCGGCCAAGTTGAATATGCCATGAACTCGAGTTCATGGCATATTCAACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-307s21c1
Sequence:CCGGGCTCGTTCATTAGCAGACATACTCGAGTATGTCTGCTAATGAACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011184.3-760s21c1
Sequence:CCGGGCAGAGAAATATGCCAAGGAACTCGAGTTCCTTGGCATATTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)