EMAIL THIS PAGE TO A FRIEND

PSMA4

proteasome (prosome, macropain) subunit, alpha type, 4

81 Gene Product Result for
Synonyms: HC9 HsT17706 PSC9
UniProtKB ID: P25789, D3DW86, Q53XP2, Q567Q5, Q8TBD1
Gene ID:
Human(5685) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(26441) proteasome (prosome, macropain) subunit, alpha type 4
Rat(29671) proteasome (prosome, macropain) subunit, alpha type 4
Zebrafish(326687) proteasome (prosome, macropain) subunit, alpha type, 4
domestic cat(101084967) proteasome (prosome, macropain) subunit, alpha type, 4
dog(475132) proteasome (prosome, macropain) subunit, alpha type, 4
chicken(415357) proteasome (prosome, macropain) subunit, alpha type, 4
domestic guinea pig(100730420) proteasome (prosome, macropain) subunit, alpha type, 4
naked mole-rat(101701639) proteasome (prosome, macropain) subunit, alpha type, 4
cow(510423) proteasome (prosome, macropain) subunit, alpha type, 4
sheep(101122816) proteasome (prosome, macropain) subunit, alpha type, 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011966 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011966 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011966 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002789 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102667 Rosetta Predictions human pricing
NM_001102668 Rosetta Predictions human pricing
NM_002789 Rosetta Predictions human pricing
NM_017281 Rosetta Predictions rat pricing
NM_011966 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323502 predicted 552
2 SASI_Hs02_00323503 predicted 583
3 SASI_Hs02_00323504 predicted 582
4 SASI_Hs02_00323505 predicted 519
5 SASI_Hs02_00323506 predicted 500
6 SASI_Hs02_00323507 predicted 517
7 SASI_Hs02_00323508 predicted 521
8 SASI_Hs02_00323509 predicted 577
9 SASI_Hs02_00323510 predicted 501
10 SASI_Hs02_00323511 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323512 predicted 469
2 SASI_Hs02_00323513 predicted 478
3 SASI_Hs02_00323514 predicted 433
4 SASI_Hs02_00323515 predicted 468
5 SASI_Hs02_00323516 predicted 419
6 SASI_Hs02_00323517 predicted 430
7 SASI_Hs02_00323518 predicted 422
8 SASI_Hs02_00323519 predicted 442
9 SASI_Hs02_00323520 predicted 418
10 SASI_Hs02_00323521 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334430 predicted 628
2 SASI_Hs02_00334431 predicted 640
3 SASI_Hs02_00334432 predicted 662
4 SASI_Hs02_00334433 predicted 657
5 SASI_Hs02_00334434 predicted 663
6 SASI_Hs02_00334435 predicted 599
7 SASI_Hs02_00334436 predicted 633
8 SASI_Hs01_00046335 predicted 583
9 SASI_Hs02_00334437 predicted 581
10 SASI_Hs02_00334438 predicted 597
11 SASI_Hs01_00046328 predicted 373
12 SASI_Hs01_00046329 predicted 279
13 SASI_Hs01_00046330 predicted 486
14 SASI_Hs01_00046331 predicted 447
15 SASI_Hs01_00046332 predicted 420
16 SASI_Hs01_00046333 predicted 287
17 SASI_Hs01_00046334 predicted 479
18 SASI_Hs01_00046336 predicted 527
19 SASI_Hs01_00046337 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017281 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079871 predicted 339
2 SASI_Rn02_00261700 predicted 540
3 SASI_Rn01_00079872 predicted 371
4 SASI_Rn01_00079873 predicted 322
5 SASI_Rn01_00079874 predicted 480
6 SASI_Rn01_00079875 predicted 495
7 SASI_Rn01_00079876 predicted 209
8 SASI_Rn01_00079877 predicted 240
9 SASI_Rn01_00079879 predicted 242
10 SASI_Rn01_00079880 predicted 363
11 SASI_Rn01_00079878 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130467 predicted 377
2 SASI_Mm01_00130468 predicted 465
3 SASI_Mm02_00321850 predicted 693
4 SASI_Mm01_00130469 predicted 663
5 SASI_Mm01_00130470 predicted 644
6 SASI_Mm01_00130472 predicted 294
7 SASI_Mm01_00130473 predicted 875
8 SASI_Mm01_00130474 predicted 307
9 SASI_Mm01_00130475 predicted 339
10 SASI_Mm01_00130476 predicted 506
11 SASI_Mm01_00130471 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011966
VALIDATED
PSMA4 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 4
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011966.2-352s1c1
Sequence:CCGGCAACGGTACTTATTACAGTATCTCGAGATACTGTAATAAGTACCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011966.2-118s1c1
Sequence:CCGGCGCTTATACCAAGTGGAATATCTCGAGATATTCCACTTGGTATAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011966.2-580s1c1
Sequence:CCGGGCTGTGTCAATGTTGAAACAACTCGAGTTGTTTCAACATTGACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011966.2-471s1c1
Sequence:CCGGGCTGTATATTGGCTGGGATAACTCGAGTTATCCCAGCCAATATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011966.2-300s1c1
Sequence:CCGGAGGCATAACATCTGATGCTAACTCGAGTTAGCATCAGATGTTATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011966.3-313s21c1
Sequence:CCGGGATGCTAACGTTCTGACTAACCTCGAGGTTAGTCAGAACGTTAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011966
VALIDATED
PSMA4 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 4
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011966.2-352s1c1
Sequence:CCGGCAACGGTACTTATTACAGTATCTCGAGATACTGTAATAAGTACCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011966.2-118s1c1
Sequence:CCGGCGCTTATACCAAGTGGAATATCTCGAGATATTCCACTTGGTATAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011966.2-580s1c1
Sequence:CCGGGCTGTGTCAATGTTGAAACAACTCGAGTTGTTTCAACATTGACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011966.2-471s1c1
Sequence:CCGGGCTGTATATTGGCTGGGATAACTCGAGTTATCCCAGCCAATATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011966.2-300s1c1
Sequence:CCGGAGGCATAACATCTGATGCTAACTCGAGTTAGCATCAGATGTTATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011966.3-313s21c1
Sequence:CCGGGATGCTAACGTTCTGACTAACCTCGAGGTTAGTCAGAACGTTAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011966
VALIDATED
PSMA4 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 4
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011966.2-352s1c1
Sequence:CCGGCAACGGTACTTATTACAGTATCTCGAGATACTGTAATAAGTACCGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011966.2-118s1c1
Sequence:CCGGCGCTTATACCAAGTGGAATATCTCGAGATATTCCACTTGGTATAAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011966.2-580s1c1
Sequence:CCGGGCTGTGTCAATGTTGAAACAACTCGAGTTGTTTCAACATTGACACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011966.2-471s1c1
Sequence:CCGGGCTGTATATTGGCTGGGATAACTCGAGTTATCCCAGCCAATATACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011966.2-300s1c1
Sequence:CCGGAGGCATAACATCTGATGCTAACTCGAGTTAGCATCAGATGTTATGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011966.3-313s21c1
Sequence:CCGGGATGCTAACGTTCTGACTAACCTCGAGGTTAGTCAGAACGTTAGCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002789
VALIDATED
PSMA4 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-380s1c1
Sequence:CCGGGATGCTAATGTTCTGACTAATCTCGAGATTAGTCAGAACATTAGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-722s1c1
Sequence:CCGGGTACTAAATAAGACCATGGATCTCGAGATCCATGGTCTTATTTAGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002789.4-545s21c1
Sequence:CCGGCTTTGGTGTTTCATTGCTGTACTCGAGTACAGCAATGAAACACCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-776s1c1
Sequence:CCGGGCAACACTAACAAGAGAGAATCTCGAGATTCTCTCTTGTTAGTGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-1039s1c1
Sequence:CCGGCATACTGAATTGGGTCCTTGTCTCGAGACAAGGACCCAATTCAGTATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-523s1c1
Sequence:CCGGCTTTGGTGTTTCATTGCTGTACTCGAGTACAGCAATGAAACACCAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002789.4-798s21c1
Sequence:CCGGGCAACACTAACAAGAGAGAATCTCGAGATTCTCTCTTGTTAGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002789.4-1061s21c1
Sequence:CCGGCATACTGAATTGGGTCCTTGTCTCGAGACAAGGACCCAATTCAGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002789.4-402s21c1
Sequence:CCGGGATGCTAATGTTCTGACTAATCTCGAGATTAGTCAGAACATTAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002789
VALIDATED
PSMA4 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-380s1c1
Sequence:CCGGGATGCTAATGTTCTGACTAATCTCGAGATTAGTCAGAACATTAGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-722s1c1
Sequence:CCGGGTACTAAATAAGACCATGGATCTCGAGATCCATGGTCTTATTTAGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002789.4-545s21c1
Sequence:CCGGCTTTGGTGTTTCATTGCTGTACTCGAGTACAGCAATGAAACACCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-776s1c1
Sequence:CCGGGCAACACTAACAAGAGAGAATCTCGAGATTCTCTCTTGTTAGTGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-1039s1c1
Sequence:CCGGCATACTGAATTGGGTCCTTGTCTCGAGACAAGGACCCAATTCAGTATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-523s1c1
Sequence:CCGGCTTTGGTGTTTCATTGCTGTACTCGAGTACAGCAATGAAACACCAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002789.4-798s21c1
Sequence:CCGGGCAACACTAACAAGAGAGAATCTCGAGATTCTCTCTTGTTAGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002789.4-1061s21c1
Sequence:CCGGCATACTGAATTGGGTCCTTGTCTCGAGACAAGGACCCAATTCAGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002789.4-402s21c1
Sequence:CCGGGATGCTAATGTTCTGACTAATCTCGAGATTAGTCAGAACATTAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002789
VALIDATED
PSMA4 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-380s1c1
Sequence:CCGGGATGCTAATGTTCTGACTAATCTCGAGATTAGTCAGAACATTAGCATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-722s1c1
Sequence:CCGGGTACTAAATAAGACCATGGATCTCGAGATCCATGGTCTTATTTAGTACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002789.4-545s21c1
Sequence:CCGGCTTTGGTGTTTCATTGCTGTACTCGAGTACAGCAATGAAACACCAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-776s1c1
Sequence:CCGGGCAACACTAACAAGAGAGAATCTCGAGATTCTCTCTTGTTAGTGTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-1039s1c1
Sequence:CCGGCATACTGAATTGGGTCCTTGTCTCGAGACAAGGACCCAATTCAGTATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002789.x-523s1c1
Sequence:CCGGCTTTGGTGTTTCATTGCTGTACTCGAGTACAGCAATGAAACACCAAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002789.4-798s21c1
Sequence:CCGGGCAACACTAACAAGAGAGAATCTCGAGATTCTCTCTTGTTAGTGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002789.4-1061s21c1
Sequence:CCGGCATACTGAATTGGGTCCTTGTCTCGAGACAAGGACCCAATTCAGTATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002789.4-402s21c1
Sequence:CCGGGATGCTAATGTTCTGACTAATCTCGAGATTAGTCAGAACATTAGCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)