EMAIL THIS PAGE TO A FRIEND

PSMA6

proteasome (prosome, macropain) subunit, alpha type, 6

55 Gene Product Result for
Synonyms: IOTA PROS27 p27K
UniProtKB ID: P60900, B2R7J9, P34062, Q6IB60
Gene ID:
Human(5687) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. A pseudogene has been identified on the Y chromosome. [provided by RefSeq, Jul 2008]
Mouse(26443) proteasome (prosome, macropain) subunit, alpha type 6
Rat(29673) proteasome (prosome, macropain) subunit, alpha type 6
chicken(423326) proteasome (prosome, macropain) subunit, alpha type, 6
domestic cat(101090365) proteasome (prosome, macropain) subunit, alpha type, 6
dog(480290) proteasome (prosome, macropain) subunit, alpha type, 6
domestic guinea pig(100721618) proteasome (prosome, macropain) subunit, alpha type, 6
naked mole-rat(101709607) proteasome (prosome, macropain) subunit, alpha type, 6
cow(507213) proteasome (prosome, macropain) subunit, alpha type, 6
sheep(100192424) proteasome (prosome, macropain) subunit, alpha type, 6
Goat(100860840) proteasome (prosome, macropain) subunit, alpha type, 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002791 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002791 Rosetta Predictions human pricing
NM_017283 Rosetta Predictions rat pricing
NM_011968 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117430 predicted 231
2 SASI_Hs01_00117431 predicted 420
3 SASI_Hs02_00334441 predicted 263
4 SASI_Hs02_00334442 predicted 392
5 SASI_Hs01_00117432 predicted 228
6 SASI_Hs01_00117433 predicted 417
7 SASI_Hs01_00117434 predicted 387
8 SASI_Hs01_00117435 predicted 370
9 SASI_Hs02_00334443 predicted 332
10 SASI_Hs02_00334444 predicted 308
11 SASI_Hs01_00117428 predicted 400
12 SASI_Hs01_00117429 predicted 275
13 SASI_Hs01_00117436 predicted 211
14 SASI_Hs01_00117437 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261703 predicted 342
2 SASI_Rn01_00056505 predicted 249
3 SASI_Rn02_00261704 predicted 252
4 SASI_Rn01_00056506 predicted 246
5 SASI_Rn01_00056508 predicted 260
6 SASI_Rn01_00056509 predicted 369
7 SASI_Rn01_00056510 predicted 286
8 SASI_Rn01_00056511 predicted 352
9 SASI_Rn01_00056513 predicted 351
10 SASI_Rn02_00261705 predicted 219
11 SASI_Rn01_00056504 predicted 282
12 SASI_Rn01_00056507 predicted 329
13 SASI_Rn01_00056512 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027893 predicted 415
2 SASI_Mm01_00027894 predicted 636
3 SASI_Mm01_00027895 predicted 272
4 SASI_Mm01_00027896 predicted 586
5 SASI_Mm01_00027897 predicted 348
6 SASI_Mm01_00027899 predicted 323
7 SASI_Mm01_00027900 predicted 640
8 SASI_Mm01_00027901 predicted 332
9 SASI_Mm01_00027902 predicted 481
10 SASI_Mm02_00321856 predicted 251
11 SASI_Mm01_00027898 predicted 505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011968
VALIDATED
PSMA6 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011968.2-502s21c1
Sequence:CCGGGCAGGTTACTACTGTGGCTTTCTCGAGAAAGCCACAGTAGTAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011968.1-429s1c1
Sequence:CCGGGCCACTCGGTTGTTGTATGATCTCGAGATCATACAACAACCGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011968.1-502s1c1
Sequence:CCGGGCAGGTTACTACTGTGGCTTTCTCGAGAAAGCCACAGTAGTAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011968.1-623s1c1
Sequence:CCGGCTGCAATTACATGCCTGTCTACTCGAGTAGACAGGCATGTAATTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011968.1-313s1c1
Sequence:CCGGGCACGCTATGAGGCAGCTAATCTCGAGATTAGCTGCCTCATAGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011968.2-429s21c1
Sequence:CCGGGCCACTCGGTTGTTGTATGATCTCGAGATCATACAACAACCGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011968.2-313s21c1
Sequence:CCGGGCACGCTATGAGGCAGCTAATCTCGAGATTAGCTGCCTCATAGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011968.2-623s21c1
Sequence:CCGGCTGCAATTACATGCCTGTCTACTCGAGTAGACAGGCATGTAATTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011968
VALIDATED
PSMA6 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011968.2-502s21c1
Sequence:CCGGGCAGGTTACTACTGTGGCTTTCTCGAGAAAGCCACAGTAGTAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011968.1-429s1c1
Sequence:CCGGGCCACTCGGTTGTTGTATGATCTCGAGATCATACAACAACCGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011968.1-502s1c1
Sequence:CCGGGCAGGTTACTACTGTGGCTTTCTCGAGAAAGCCACAGTAGTAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011968.1-623s1c1
Sequence:CCGGCTGCAATTACATGCCTGTCTACTCGAGTAGACAGGCATGTAATTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011968.1-313s1c1
Sequence:CCGGGCACGCTATGAGGCAGCTAATCTCGAGATTAGCTGCCTCATAGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011968.2-429s21c1
Sequence:CCGGGCCACTCGGTTGTTGTATGATCTCGAGATCATACAACAACCGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011968.2-313s21c1
Sequence:CCGGGCACGCTATGAGGCAGCTAATCTCGAGATTAGCTGCCTCATAGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011968.2-623s21c1
Sequence:CCGGCTGCAATTACATGCCTGTCTACTCGAGTAGACAGGCATGTAATTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011968
VALIDATED
PSMA6 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011968.2-502s21c1
Sequence:CCGGGCAGGTTACTACTGTGGCTTTCTCGAGAAAGCCACAGTAGTAACCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011968.1-429s1c1
Sequence:CCGGGCCACTCGGTTGTTGTATGATCTCGAGATCATACAACAACCGAGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011968.1-502s1c1
Sequence:CCGGGCAGGTTACTACTGTGGCTTTCTCGAGAAAGCCACAGTAGTAACCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011968.1-623s1c1
Sequence:CCGGCTGCAATTACATGCCTGTCTACTCGAGTAGACAGGCATGTAATTGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011968.1-313s1c1
Sequence:CCGGGCACGCTATGAGGCAGCTAATCTCGAGATTAGCTGCCTCATAGCGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011968.2-429s21c1
Sequence:CCGGGCCACTCGGTTGTTGTATGATCTCGAGATCATACAACAACCGAGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011968.2-313s21c1
Sequence:CCGGGCACGCTATGAGGCAGCTAATCTCGAGATTAGCTGCCTCATAGCGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011968.2-623s21c1
Sequence:CCGGCTGCAATTACATGCCTGTCTACTCGAGTAGACAGGCATGTAATTGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002791
VALIDATED
PSMA6 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002791.1-339s21c1
Sequence:CCGGGTTGTGTGATGACCGGAATGACTCGAGTCATTCCGGTCATCACACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002791.1-901s21c1
Sequence:CCGGGTAACAACAAACCAACATCATCTCGAGATGATGTTGGTTTGTTGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022370    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002791.1-377s1c1
Sequence:CCGGCAGGTACAGAGGGCACGCTATCTCGAGATAGCGTGCCCTCTGTACCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022373    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002791.1-346s1c1
Sequence:CCGGGATGACCGGAATGACAGCTGACTCGAGTCAGCTGTCATTCCGGTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022372    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002791.1-348s1c1
Sequence:CCGGTGACCGGAATGACAGCTGACACTCGAGTGTCAGCTGTCATTCCGGTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022371    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002791.1-339s1c1
Sequence:CCGGGTTGTGTGATGACCGGAATGACTCGAGTCATTCCGGTCATCACACAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022369    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002791.1-901s1c1
Sequence:CCGGGTAACAACAAACCAACATCATCTCGAGATGATGTTGGTTTGTTGTTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002791.1-348s21c1
Sequence:CCGGTGACCGGAATGACAGCTGACACTCGAGTGTCAGCTGTCATTCCGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002791.1-377s21c1
Sequence:CCGGCAGGTACAGAGGGCACGCTATCTCGAGATAGCGTGCCCTCTGTACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002791
VALIDATED
PSMA6 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002791.1-339s21c1
Sequence:CCGGGTTGTGTGATGACCGGAATGACTCGAGTCATTCCGGTCATCACACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002791.1-901s21c1
Sequence:CCGGGTAACAACAAACCAACATCATCTCGAGATGATGTTGGTTTGTTGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022370    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002791.1-377s1c1
Sequence:CCGGCAGGTACAGAGGGCACGCTATCTCGAGATAGCGTGCCCTCTGTACCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022373    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002791.1-346s1c1
Sequence:CCGGGATGACCGGAATGACAGCTGACTCGAGTCAGCTGTCATTCCGGTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022372    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002791.1-348s1c1
Sequence:CCGGTGACCGGAATGACAGCTGACACTCGAGTGTCAGCTGTCATTCCGGTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022371    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002791.1-339s1c1
Sequence:CCGGGTTGTGTGATGACCGGAATGACTCGAGTCATTCCGGTCATCACACAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022369    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002791.1-901s1c1
Sequence:CCGGGTAACAACAAACCAACATCATCTCGAGATGATGTTGGTTTGTTGTTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002791.1-348s21c1
Sequence:CCGGTGACCGGAATGACAGCTGACACTCGAGTGTCAGCTGTCATTCCGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002791.1-377s21c1
Sequence:CCGGCAGGTACAGAGGGCACGCTATCTCGAGATAGCGTGCCCTCTGTACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002791
VALIDATED
PSMA6 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002791.1-339s21c1
Sequence:CCGGGTTGTGTGATGACCGGAATGACTCGAGTCATTCCGGTCATCACACAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002791.1-901s21c1
Sequence:CCGGGTAACAACAAACCAACATCATCTCGAGATGATGTTGGTTTGTTGTTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022370    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002791.1-377s1c1
Sequence:CCGGCAGGTACAGAGGGCACGCTATCTCGAGATAGCGTGCCCTCTGTACCTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022373    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002791.1-346s1c1
Sequence:CCGGGATGACCGGAATGACAGCTGACTCGAGTCAGCTGTCATTCCGGTCATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022372    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002791.1-348s1c1
Sequence:CCGGTGACCGGAATGACAGCTGACACTCGAGTGTCAGCTGTCATTCCGGTCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022371    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002791.1-339s1c1
Sequence:CCGGGTTGTGTGATGACCGGAATGACTCGAGTCATTCCGGTCATCACACAACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022369    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002791.1-901s1c1
Sequence:CCGGGTAACAACAAACCAACATCATCTCGAGATGATGTTGGTTTGTTGTTACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002791.1-348s21c1
Sequence:CCGGTGACCGGAATGACAGCTGACACTCGAGTGTCAGCTGTCATTCCGGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002791.1-377s21c1
Sequence:CCGGCAGGTACAGAGGGCACGCTATCTCGAGATAGCGTGCCCTCTGTACCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)