EMAIL THIS PAGE TO A FRIEND

PSMA7

proteasome (prosome, macropain) subunit, alpha type, 7

58 Gene Product Result for
Synonyms: C6 HSPC RC6-1 XAPC7
UniProtKB ID: O14818, B2R515, Q5JXJ2, Q9BR53, Q9H4K5, Q9UEU8
Gene ID:
Human(5688) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the peptidase T1A family that functions as a 20S core alpha subunit. The encoded protein interacts with the hepatitis B virus X protein and plays a role in regulating hepatitis C virus internal ribosome entry site (IRES) activity, an activity essential for viral replication. The encoded protein also plays a role in the cellular stress response by regulating hypoxia-inducible factor-1alpha. A pseudogene of this gene is located on the long arm of chromosome 9. [provided by RefSeq, Jul 2012]
Mouse(26444) proteasome (prosome, macropain) subunit, alpha type 7
Rat(29674) proteasome (prosome, macropain) subunit, alpha type 7
chicken(395318) proteasome (prosome, macropain) subunit, alpha type, 7
dog(404305) proteasome (prosome, macropain) subunit, alpha type, 7
domestic cat(101084949) proteasome (prosome, macropain) subunit, alpha type, 7
cow(505050) proteasome (prosome, macropain) subunit, alpha type, 7
sheep(101121959) proteasome (prosome, macropain) subunit, alpha type, 7
naked mole-rat(101697423) proteasome (prosome, macropain) subunit, alpha type, 7
domestic guinea pig(100713525) proteasome (prosome, macropain) subunit, alpha type, 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002792 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011969 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011969 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011969 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002792 siRNAs that have been validated in the lab human pricing
NM_001008217 Rosetta Predictions rat pricing
XM_579184 Rosetta Predictions rat pricing
NM_011969 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002792 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064600 validated 510
1 SASI_Hs01_00064606 validated 534
1 SASI_Hs01_00064602 validated 449
2 SASI_Hs01_00064601 predicted 507
3 SASI_Hs02_00334445 predicted 461
4 SASI_Hs01_00064603 predicted 513
5 SASI_Hs01_00064604 predicted 445
6 SASI_Hs02_00334446 predicted 488
7 SASI_Hs01_00064605 predicted 505
8 SASI_Hs01_00064607 predicted 564
9 SASI_Hs01_00064608 predicted 342
10 SASI_Hs01_00064609 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198971 predicted 366
2 SASI_Rn01_00053894 predicted 445
3 SASI_Rn01_00053895 predicted 403
4 SASI_Rn02_00198972 predicted 422
5 SASI_Rn01_00053896 predicted 247
6 SASI_Rn01_00053898 predicted 380
7 SASI_Rn01_00053899 predicted 260
8 SASI_Rn02_00198973 predicted 436
9 SASI_Rn02_00198974 predicted 375
10 SASI_Rn02_00198975 predicted 308
11 SASI_Rn01_00053897 predicted 455
12 SASI_Rn01_00053900 predicted 291
13 SASI_Rn01_00053901 predicted 414
14 SASI_Rn01_00053902 predicted 386
15 SASI_Rn01_00053903 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174183 predicted 458
2 SASI_Rn01_00174184 predicted 412
3 SASI_Rn01_00174185 predicted 248
4 SASI_Rn01_00174186 predicted 453
5 SASI_Rn01_00174187 predicted 386
6 SASI_Rn01_00174188 predicted 259
7 SASI_Rn01_00174189 predicted 285
8 SASI_Rn01_00174190 predicted 408
9 SASI_Rn01_00174191 predicted 384
10 SASI_Rn01_00174192 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011969 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101166 predicted 437
2 SASI_Mm01_00101167 predicted 370
3 SASI_Mm01_00101168 predicted 413
4 SASI_Mm01_00101169 predicted 394
5 SASI_Mm01_00101170 predicted 383
6 SASI_Mm01_00101171 predicted 437
7 SASI_Mm02_00321857 predicted 381
8 SASI_Mm01_00101172 predicted 479
9 SASI_Mm01_00101173 predicted 477
10 SASI_Mm01_00101174 predicted 474
11 SASI_Mm01_00101175 predicted 377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002792
VALIDATED
PSMA7 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002792.2-280s21c1
Sequence:CCGGTGAAAGAACAGTGCGGAAGATCTCGAGATCTTCCGCACTGTTCTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002792.2-934s21c1
Sequence:CCGGTCCATTCCATTTATTCACACTCTCGAGAGTGTGAATAAATGGAATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002792.2-522s21c1
Sequence:CCGGTCGACTTTGATGGCACTCCTACTCGAGTAGGAGTGCCATCAAAGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002792.2-791s21c1
Sequence:CCGGGAGAAGTATGTTGCTGAAATTCTCGAGAATTTCAGCAACATACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002792.x-791s1c1
Sequence:CCGGGAGAAGTATGTTGCTGAAATTCTCGAGAATTTCAGCAACATACTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002792.x-345s1c1
Sequence:CCGGCCGCCGATGCAAGGATAGTCACTCGAGTGACTATCCTTGCATCGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002792.x-522s1c1
Sequence:CCGGTCGACTTTGATGGCACTCCTACTCGAGTAGGAGTGCCATCAAAGTCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002792.x-280s1c1
Sequence:CCGGTGAAAGAACAGTGCGGAAGATCTCGAGATCTTCCGCACTGTTCTTTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002792.x-934s1c1
Sequence:CCGGTCCATTCCATTTATTCACACTCTCGAGAGTGTGAATAAATGGAATGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002792
VALIDATED
PSMA7 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002792.2-280s21c1
Sequence:CCGGTGAAAGAACAGTGCGGAAGATCTCGAGATCTTCCGCACTGTTCTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002792.2-934s21c1
Sequence:CCGGTCCATTCCATTTATTCACACTCTCGAGAGTGTGAATAAATGGAATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002792.2-522s21c1
Sequence:CCGGTCGACTTTGATGGCACTCCTACTCGAGTAGGAGTGCCATCAAAGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002792.2-791s21c1
Sequence:CCGGGAGAAGTATGTTGCTGAAATTCTCGAGAATTTCAGCAACATACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002792.x-791s1c1
Sequence:CCGGGAGAAGTATGTTGCTGAAATTCTCGAGAATTTCAGCAACATACTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002792.x-345s1c1
Sequence:CCGGCCGCCGATGCAAGGATAGTCACTCGAGTGACTATCCTTGCATCGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002792.x-522s1c1
Sequence:CCGGTCGACTTTGATGGCACTCCTACTCGAGTAGGAGTGCCATCAAAGTCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002792.x-280s1c1
Sequence:CCGGTGAAAGAACAGTGCGGAAGATCTCGAGATCTTCCGCACTGTTCTTTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002792.x-934s1c1
Sequence:CCGGTCCATTCCATTTATTCACACTCTCGAGAGTGTGAATAAATGGAATGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002792
VALIDATED
PSMA7 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002792.2-280s21c1
Sequence:CCGGTGAAAGAACAGTGCGGAAGATCTCGAGATCTTCCGCACTGTTCTTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002792.2-934s21c1
Sequence:CCGGTCCATTCCATTTATTCACACTCTCGAGAGTGTGAATAAATGGAATGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002792.2-522s21c1
Sequence:CCGGTCGACTTTGATGGCACTCCTACTCGAGTAGGAGTGCCATCAAAGTCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002792.2-791s21c1
Sequence:CCGGGAGAAGTATGTTGCTGAAATTCTCGAGAATTTCAGCAACATACTTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002792.x-791s1c1
Sequence:CCGGGAGAAGTATGTTGCTGAAATTCTCGAGAATTTCAGCAACATACTTCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002792.x-345s1c1
Sequence:CCGGCCGCCGATGCAAGGATAGTCACTCGAGTGACTATCCTTGCATCGGCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002792.x-522s1c1
Sequence:CCGGTCGACTTTGATGGCACTCCTACTCGAGTAGGAGTGCCATCAAAGTCGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002792.x-280s1c1
Sequence:CCGGTGAAAGAACAGTGCGGAAGATCTCGAGATCTTCCGCACTGTTCTTTCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002792.x-934s1c1
Sequence:CCGGTCCATTCCATTTATTCACACTCTCGAGAGTGTGAATAAATGGAATGGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011969
VALIDATED
PSMA7 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-135s21c1
Sequence:CCGGCGAGGAAAGGACATTGTTGTTCTCGAGAACAACAATGTCCTTTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-374s21c1
Sequence:CCGGGCAGCGTTATACACAGAGCAACTCGAGTTGCTCTGTGTATAACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-260s21c1
Sequence:CCGGCGCTGATGCAAGGATAGTCATCTCGAGATGACTATCCTTGCATCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-522s21c1
Sequence:CCGGGCCAAGTCAGTGCGTGAATTTCTCGAGAAATTCACGCACTGACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011969.1-374s1c1
Sequence:CCGGGCAGCGTTATACACAGAGCAACTCGAGTTGCTCTGTGTATAACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011969.1-522s1c1
Sequence:CCGGGCCAAGTCAGTGCGTGAATTTCTCGAGAAATTCACGCACTGACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011969.1-260s1c1
Sequence:CCGGCGCTGATGCAAGGATAGTCATCTCGAGATGACTATCCTTGCATCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011969.1-135s1c1
Sequence:CCGGCGAGGAAAGGACATTGTTGTTCTCGAGAACAACAATGTCCTTTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011969.1-693s1c1
Sequence:CCGGCCTGAAGAAATTGAGAAGTATCTCGAGATACTTCTCAATTTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-693s21c1
Sequence:CCGGCCTGAAGAAATTGAGAAGTATCTCGAGATACTTCTCAATTTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011969
VALIDATED
PSMA7 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-135s21c1
Sequence:CCGGCGAGGAAAGGACATTGTTGTTCTCGAGAACAACAATGTCCTTTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-374s21c1
Sequence:CCGGGCAGCGTTATACACAGAGCAACTCGAGTTGCTCTGTGTATAACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-260s21c1
Sequence:CCGGCGCTGATGCAAGGATAGTCATCTCGAGATGACTATCCTTGCATCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-522s21c1
Sequence:CCGGGCCAAGTCAGTGCGTGAATTTCTCGAGAAATTCACGCACTGACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011969.1-374s1c1
Sequence:CCGGGCAGCGTTATACACAGAGCAACTCGAGTTGCTCTGTGTATAACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011969.1-522s1c1
Sequence:CCGGGCCAAGTCAGTGCGTGAATTTCTCGAGAAATTCACGCACTGACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011969.1-260s1c1
Sequence:CCGGCGCTGATGCAAGGATAGTCATCTCGAGATGACTATCCTTGCATCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011969.1-135s1c1
Sequence:CCGGCGAGGAAAGGACATTGTTGTTCTCGAGAACAACAATGTCCTTTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011969.1-693s1c1
Sequence:CCGGCCTGAAGAAATTGAGAAGTATCTCGAGATACTTCTCAATTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-693s21c1
Sequence:CCGGCCTGAAGAAATTGAGAAGTATCTCGAGATACTTCTCAATTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011969
VALIDATED
PSMA7 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-135s21c1
Sequence:CCGGCGAGGAAAGGACATTGTTGTTCTCGAGAACAACAATGTCCTTTCCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-374s21c1
Sequence:CCGGGCAGCGTTATACACAGAGCAACTCGAGTTGCTCTGTGTATAACGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-260s21c1
Sequence:CCGGCGCTGATGCAAGGATAGTCATCTCGAGATGACTATCCTTGCATCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-522s21c1
Sequence:CCGGGCCAAGTCAGTGCGTGAATTTCTCGAGAAATTCACGCACTGACTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011969.1-374s1c1
Sequence:CCGGGCAGCGTTATACACAGAGCAACTCGAGTTGCTCTGTGTATAACGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011969.1-522s1c1
Sequence:CCGGGCCAAGTCAGTGCGTGAATTTCTCGAGAAATTCACGCACTGACTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011969.1-260s1c1
Sequence:CCGGCGCTGATGCAAGGATAGTCATCTCGAGATGACTATCCTTGCATCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011969.1-135s1c1
Sequence:CCGGCGAGGAAAGGACATTGTTGTTCTCGAGAACAACAATGTCCTTTCCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011969.1-693s1c1
Sequence:CCGGCCTGAAGAAATTGAGAAGTATCTCGAGATACTTCTCAATTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011969.1-693s21c1
Sequence:CCGGCCTGAAGAAATTGAGAAGTATCTCGAGATACTTCTCAATTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)