EMAIL THIS PAGE TO A FRIEND

PSMA8

proteasome (prosome, macropain) subunit, alpha type, 8

88 Gene Product Result for
Synonyms: PSMA7L
UniProtKB ID: Q8TAA3, B0YJ75, Q8IVP4, Q8TA98, Q8TAA2
Gene ID:
Mouse(73677) proteasome (prosome, macropain) subunit, alpha type, 8
Rat(364814) proteasome (prosome, macropain) subunit, alpha type, 8
Zebrafish(406445) proteasome (prosome, macropain) subunit, alpha type, 8
domestic cat(101101091) proteasome (prosome, macropain) subunit, alpha type, 8
dog(490508) proteasome (prosome, macropain) subunit, alpha type, 8
domestic guinea pig(100717113) proteasome (prosome, macropain) subunit, alpha type, 8
naked mole-rat(101703620) proteasome (prosome, macropain) subunit, alpha type, 8
cow(614703) proteasome (prosome, macropain) subunit, alpha type, 8
sheep(101117634) proteasome (prosome, macropain) subunit, alpha type, 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144662 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_357002 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_357002 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_357002 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025096 Rosetta Predictions human pricing
NM_001025097 Rosetta Predictions human pricing
NM_144662 Rosetta Predictions human pricing
NM_001108884 Rosetta Predictions rat pricing
XM_357002 Rosetta Predictions mouse pricing
XM_906754 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095794 predicted 562
2 SASI_Hs01_00095795 predicted 578
3 SASI_Hs01_00095798 predicted 554
4 SASI_Hs01_00095799 predicted 565
5 SASI_Hs01_00095800 predicted 555
6 SASI_Hs01_00095802 predicted 583
7 SASI_Hs01_00095803 predicted 581
8 SASI_Hs02_00307362 predicted 567
9 SASI_Hs02_00307363 predicted 542
10 SASI_Hs01_00095797 predicted 558
11 SASI_Hs01_00095796 predicted 551
12 SASI_Hs01_00095801 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145523 predicted 441
2 SASI_Hs01_00145524 predicted 464
3 SASI_Hs01_00145525 predicted 622
4 SASI_Hs01_00145526 predicted 638
5 SASI_Hs01_00145528 predicted 541
6 SASI_Hs01_00145529 predicted 439
7 SASI_Hs01_00145530 predicted 539
8 SASI_Hs01_00145531 predicted 562
9 SASI_Hs01_00145532 predicted 558
10 SASI_Hs02_00307364 predicted 589
11 SASI_Hs01_00145527 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093428 predicted 574
2 SASI_Hs01_00093429 predicted 599
3 SASI_Hs01_00093432 predicted 575
4 SASI_Hs01_00093433 predicted 579
5 SASI_Hs01_00093434 predicted 573
6 SASI_Hs01_00093436 predicted 595
7 SASI_Hs01_00093437 predicted 597
8 SASI_Hs02_00364545 predicted 606
9 SASI_Hs02_00364546 predicted 592
10 SASI_Hs02_00364547 predicted 557
11 SASI_Hs01_00093430 predicted 571
12 SASI_Hs01_00093431 predicted 576
13 SASI_Hs01_00093435 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243035 predicted 574
2 SASI_Rn02_00243036 predicted 658
3 SASI_Rn02_00243037 predicted 447
4 SASI_Rn02_00243038 predicted 487
5 SASI_Rn02_00243039 predicted 877
6 SASI_Rn02_00243040 predicted 511
7 SASI_Rn02_00243041 predicted 263
8 SASI_Rn02_00243042 predicted 428
9 SASI_Rn02_00243043 predicted 410
10 SASI_Rn02_00243044 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426016 predicted 444
2 SASI_Mm01_00258093 predicted 418
3 SASI_Mm01_00258094 predicted 443
4 SASI_Mm01_00258095 predicted 344
5 SASI_Mm01_00258097 predicted 504
6 SASI_Mm02_00426017 predicted 577
7 SASI_Mm01_00258098 predicted 265
8 SASI_Mm01_00258099 predicted 730
9 SASI_Mm01_00258100 predicted 500
10 SASI_Mm01_00258101 predicted 715
11 SASI_Mm01_00258092 predicted 638
12 SASI_Mm01_00258096 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432723 predicted 450
2 SASI_Mm02_00432724 predicted 426
3 SASI_Mm02_00432725 predicted 443
4 SASI_Mm02_00432726 predicted 344
5 SASI_Mm02_00432727 predicted 497
6 SASI_Mm02_00432728 predicted 572
7 SASI_Mm02_00432729 predicted 268
8 SASI_Mm02_00432730 predicted 727
9 SASI_Mm02_00432731 predicted 503
10 SASI_Mm02_00432732 predicted 717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144662
PSMA8 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144662.2-689s21c1
Sequence:CCGGACAGTGAAGCTATCAAGTTAGCTCGAGCTAACTTGATAGCTTCACTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144662.1-462s1c1
Sequence:CCGGCAGAAATATACCCAAAGCAATCTCGAGATTGCTTTGGGTATATTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144662.1-562s1c1
Sequence:CCGGCTTCTGGTACTTATCATGCTTCTCGAGAAGCATGATAAGTACCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144662.1-719s1c1
Sequence:CCGGTGGTGGAAGAAACATTGAACTCTCGAGAGTTCAATGTTTCTTCCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144662.1-360s1c1
Sequence:CCGGGTAGTAATAAACAGAGCCCGTCTCGAGACGGGCTCTGTTTATTACTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144662.2-928s21c1
Sequence:CCGGTGTACTGCCTGAGGTTGTTTACTCGAGTAAACAACCTCAGGCAGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144662.2-460s21c1
Sequence:CCGGACTCGCTTCATAGCAACTTTACTCGAGTAAAGTTGCTATGAAGCGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144662.2-894s21c1
Sequence:CCGGATGACCACTGGGAGGTCTTAACTCGAGTTAAGACCTCCCAGTGGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144662
PSMA8 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144662.2-689s21c1
Sequence:CCGGACAGTGAAGCTATCAAGTTAGCTCGAGCTAACTTGATAGCTTCACTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144662.1-462s1c1
Sequence:CCGGCAGAAATATACCCAAAGCAATCTCGAGATTGCTTTGGGTATATTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144662.1-562s1c1
Sequence:CCGGCTTCTGGTACTTATCATGCTTCTCGAGAAGCATGATAAGTACCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144662.1-719s1c1
Sequence:CCGGTGGTGGAAGAAACATTGAACTCTCGAGAGTTCAATGTTTCTTCCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144662.1-360s1c1
Sequence:CCGGGTAGTAATAAACAGAGCCCGTCTCGAGACGGGCTCTGTTTATTACTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144662.2-928s21c1
Sequence:CCGGTGTACTGCCTGAGGTTGTTTACTCGAGTAAACAACCTCAGGCAGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144662.2-460s21c1
Sequence:CCGGACTCGCTTCATAGCAACTTTACTCGAGTAAAGTTGCTATGAAGCGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144662.2-894s21c1
Sequence:CCGGATGACCACTGGGAGGTCTTAACTCGAGTTAAGACCTCCCAGTGGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144662
PSMA8 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144662.2-689s21c1
Sequence:CCGGACAGTGAAGCTATCAAGTTAGCTCGAGCTAACTTGATAGCTTCACTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144662.1-462s1c1
Sequence:CCGGCAGAAATATACCCAAAGCAATCTCGAGATTGCTTTGGGTATATTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144662.1-562s1c1
Sequence:CCGGCTTCTGGTACTTATCATGCTTCTCGAGAAGCATGATAAGTACCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144662.1-719s1c1
Sequence:CCGGTGGTGGAAGAAACATTGAACTCTCGAGAGTTCAATGTTTCTTCCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144662.1-360s1c1
Sequence:CCGGGTAGTAATAAACAGAGCCCGTCTCGAGACGGGCTCTGTTTATTACTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144662.2-928s21c1
Sequence:CCGGTGTACTGCCTGAGGTTGTTTACTCGAGTAAACAACCTCAGGCAGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144662.2-460s21c1
Sequence:CCGGACTCGCTTCATAGCAACTTTACTCGAGTAAAGTTGCTATGAAGCGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144662.2-894s21c1
Sequence:CCGGATGACCACTGGGAGGTCTTAACTCGAGTTAAGACCTCCCAGTGGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_357002
PSMA8 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-308s1c1
Sequence:CCGGCCGTCACTGTAGAGTATATAACTCGAGTTATATACTCTACAGTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-430s1c1
Sequence:CCGGCCAAGATTGTATCAGACAGATCTCGAGATCTGTCTGATACAATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-340s1c1
Sequence:CCGGGCGACGCTAAAGCAGAAATATCTCGAGATATTTCTGCTTTAGCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-101s1c1
Sequence:CCGGCGGTTGGAATTCGAGGAACTACTCGAGTAGTTCCTCGAATTCCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-544s1c1
Sequence:CCGGGCAATTTCAAATGACAAGGAACTCGAGTTCCTTGTCATTTGAAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_357002
PSMA8 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-308s1c1
Sequence:CCGGCCGTCACTGTAGAGTATATAACTCGAGTTATATACTCTACAGTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-430s1c1
Sequence:CCGGCCAAGATTGTATCAGACAGATCTCGAGATCTGTCTGATACAATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-340s1c1
Sequence:CCGGGCGACGCTAAAGCAGAAATATCTCGAGATATTTCTGCTTTAGCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-101s1c1
Sequence:CCGGCGGTTGGAATTCGAGGAACTACTCGAGTAGTTCCTCGAATTCCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-544s1c1
Sequence:CCGGGCAATTTCAAATGACAAGGAACTCGAGTTCCTTGTCATTTGAAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_357002
PSMA8 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-308s1c1
Sequence:CCGGCCGTCACTGTAGAGTATATAACTCGAGTTATATACTCTACAGTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-430s1c1
Sequence:CCGGCCAAGATTGTATCAGACAGATCTCGAGATCTGTCTGATACAATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-340s1c1
Sequence:CCGGGCGACGCTAAAGCAGAAATATCTCGAGATATTTCTGCTTTAGCGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-101s1c1
Sequence:CCGGCGGTTGGAATTCGAGGAACTACTCGAGTAGTTCCTCGAATTCCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357002.1-544s1c1
Sequence:CCGGGCAATTTCAAATGACAAGGAACTCGAGTTCCTTGTCATTTGAAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)