EMAIL THIS PAGE TO A FRIEND

PSMB10

proteasome (prosome, macropain) subunit, beta type, 10

138 Gene Product Result for
Synonyms: LMP10 MECL1 beta2i
UniProtKB ID: P40306, B2R5J4, Q5U098
Gene ID:
Human(5699) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. Proteolytic processing is required to generate a mature subunit. Expression of this gene is induced by gamma interferon, and this gene product replaces catalytic subunit 2 (proteasome beta 7 subunit) in the immunoproteasome. [provided by RefSeq, Jul 2008]
Mouse(19171) proteasome (prosome, macropain) subunit, beta type 10
Rat(291983) proteasome (prosome, macropain) subunit, beta type 10
domestic guinea pig(100730197) proteasome (prosome, macropain) subunit, beta type, 10
naked mole-rat(101701334) proteasome (prosome, macropain) subunit, beta type, 10
cow(282328) proteasome (prosome, macropain) subunit, beta type, 10
sheep(101116929) proteasome (prosome, macropain) subunit, beta type, 10
Zebrafish(64280) proteasome (prosome, macropain) subunit, beta type, 10
domestic cat(101082199) proteasome (prosome, macropain) subunit, beta type, 10
dog(489749) proteasome (prosome, macropain) subunit, beta type, 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002801 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013640 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013640 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013640 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU034751 MISSION® esiRNA esiRNA targeting mouse Psmb10 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002801 Rosetta Predictions human pricing
NM_001025637 Rosetta Predictions rat pricing
NM_013640 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240406 predicted 250
2 SASI_Hs01_00240407 predicted 398
3 SASI_Hs01_00240408 predicted 393
4 SASI_Hs01_00240409 predicted 288
5 SASI_Hs01_00240410 predicted 728
6 SASI_Hs01_00240412 predicted 259
7 SASI_Hs01_00240413 predicted 295
8 SASI_Hs01_00240414 predicted 367
9 SASI_Hs01_00240415 predicted 378
10 SASI_Hs02_00334463 predicted 569
11 SASI_Hs01_00240411 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078669 predicted 474
2 SASI_Rn01_00078670 predicted 289
3 SASI_Rn01_00078671 predicted 291
4 SASI_Rn01_00078672 predicted 242
5 SASI_Rn01_00078673 predicted 679
6 SASI_Rn01_00078674 predicted 253
7 SASI_Rn02_00203208 predicted 554
8 SASI_Rn01_00078675 predicted 229
9 SASI_Rn01_00078676 predicted 319
10 SASI_Rn01_00078677 predicted 282
11 SASI_Rn01_00078678 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156997 predicted 238
2 SASI_Mm01_00156998 predicted 663
3 SASI_Mm01_00156999 predicted 389
4 SASI_Mm01_00157000 predicted 535
5 SASI_Mm01_00157001 predicted 268
6 SASI_Mm01_00157002 predicted 272
7 SASI_Mm01_00157003 predicted 260
8 SASI_Mm01_00157004 predicted 243
9 SASI_Mm02_00322438 predicted 301
10 SASI_Mm01_00157005 predicted 192
11 SASI_Mm01_00157006 predicted 541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002801
VALIDATED
PSMB10 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-298s21c1
Sequence:CCGGCGGACAAGAGCTGCGAGAAGACTCGAGTCTTCTCGCAGCTCTTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002801.x-901s1c1
Sequence:CCGGTGCAGGCTATGGAGGTGGAGTCTCGAGACTCCACCTCCATAGCCTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002801.x-749s1c1
Sequence:CCGGGATCACAAAGACTGGCGCCAACTCGAGTTGGCGCCAGTCTTTGTGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002801.x-298s1c1
Sequence:CCGGCGGACAAGAGCTGCGAGAAGACTCGAGTCTTCTCGCAGCTCTTGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002801.x-268s1c1
Sequence:CCGGATACGCGAGCCACTAACGATTCTCGAGAATCGTTAGTGGCTCGCGTATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-403s21c1
Sequence:CCGGAGATGGAGCTACACGCGTTATCTCGAGATAACGCGTGTAGCTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-268s21c1
Sequence:CCGGATACGCGAGCCACTAACGATTCTCGAGAATCGTTAGTGGCTCGCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-150s21c1
Sequence:CCGGTGCCAAAGAAATGCATCATTGCTCGAGCAATGATGCATTTCTTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-821s21c1
Sequence:CCGGCTACCACTTTGTGCCTGGAACCTCGAGGTTCCAGGCACAAAGTGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002801
VALIDATED
PSMB10 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-298s21c1
Sequence:CCGGCGGACAAGAGCTGCGAGAAGACTCGAGTCTTCTCGCAGCTCTTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002801.x-901s1c1
Sequence:CCGGTGCAGGCTATGGAGGTGGAGTCTCGAGACTCCACCTCCATAGCCTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002801.x-749s1c1
Sequence:CCGGGATCACAAAGACTGGCGCCAACTCGAGTTGGCGCCAGTCTTTGTGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002801.x-298s1c1
Sequence:CCGGCGGACAAGAGCTGCGAGAAGACTCGAGTCTTCTCGCAGCTCTTGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002801.x-268s1c1
Sequence:CCGGATACGCGAGCCACTAACGATTCTCGAGAATCGTTAGTGGCTCGCGTATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-403s21c1
Sequence:CCGGAGATGGAGCTACACGCGTTATCTCGAGATAACGCGTGTAGCTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-268s21c1
Sequence:CCGGATACGCGAGCCACTAACGATTCTCGAGAATCGTTAGTGGCTCGCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-150s21c1
Sequence:CCGGTGCCAAAGAAATGCATCATTGCTCGAGCAATGATGCATTTCTTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-821s21c1
Sequence:CCGGCTACCACTTTGTGCCTGGAACCTCGAGGTTCCAGGCACAAAGTGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002801
VALIDATED
PSMB10 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-298s21c1
Sequence:CCGGCGGACAAGAGCTGCGAGAAGACTCGAGTCTTCTCGCAGCTCTTGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002801.x-901s1c1
Sequence:CCGGTGCAGGCTATGGAGGTGGAGTCTCGAGACTCCACCTCCATAGCCTGCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002801.x-749s1c1
Sequence:CCGGGATCACAAAGACTGGCGCCAACTCGAGTTGGCGCCAGTCTTTGTGATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002801.x-298s1c1
Sequence:CCGGCGGACAAGAGCTGCGAGAAGACTCGAGTCTTCTCGCAGCTCTTGTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002801.x-268s1c1
Sequence:CCGGATACGCGAGCCACTAACGATTCTCGAGAATCGTTAGTGGCTCGCGTATTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-403s21c1
Sequence:CCGGAGATGGAGCTACACGCGTTATCTCGAGATAACGCGTGTAGCTCCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-268s21c1
Sequence:CCGGATACGCGAGCCACTAACGATTCTCGAGAATCGTTAGTGGCTCGCGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-150s21c1
Sequence:CCGGTGCCAAAGAAATGCATCATTGCTCGAGCAATGATGCATTTCTTTGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002801.2-821s21c1
Sequence:CCGGCTACCACTTTGTGCCTGGAACCTCGAGGTTCCAGGCACAAAGTGGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013640
PSMB10 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013640.3-1012s21c1
Sequence:CCGGCAATGTGGATGCCTGTGTGATCTCGAGATCACACAGGCATCCACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013640.3-409s21c1
Sequence:CCGGAGGAGGCTTCTCTTTCGAGAACTCGAGTTCTCGAAAGAGAAGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-395s1c1
Sequence:CCGGGCTTCCAAGATGGAACTACATCTCGAGATGTAGTTCCATCTTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-307s1c1
Sequence:CCGGCTGCGAGAAGATCCACTTCATCTCGAGATGAAGTGGATCTTCTCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-272s1c1
Sequence:CCGGCGGGCCACTAACGATTCGGTTCTCGAGAACCGAATCGTTAGTGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-730s1c1
Sequence:CCGGCAATGTGGATGCCTGTGTGATCTCGAGATCACACAGGCATCCACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-127s1c1
Sequence:CCGGAGGAGGCTTCTCTTTCGAGAACTCGAGTTCTCGAAAGAGAAGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013640.3-589s21c1
Sequence:CCGGCTGCGAGAAGATCCACTTCATCTCGAGATGAAGTGGATCTTCTCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013640.3-554s21c1
Sequence:CCGGCGGGCCACTAACGATTCGGTTCTCGAGAACCGAATCGTTAGTGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013640
PSMB10 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013640.3-1012s21c1
Sequence:CCGGCAATGTGGATGCCTGTGTGATCTCGAGATCACACAGGCATCCACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013640.3-409s21c1
Sequence:CCGGAGGAGGCTTCTCTTTCGAGAACTCGAGTTCTCGAAAGAGAAGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-395s1c1
Sequence:CCGGGCTTCCAAGATGGAACTACATCTCGAGATGTAGTTCCATCTTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-307s1c1
Sequence:CCGGCTGCGAGAAGATCCACTTCATCTCGAGATGAAGTGGATCTTCTCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-272s1c1
Sequence:CCGGCGGGCCACTAACGATTCGGTTCTCGAGAACCGAATCGTTAGTGGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-730s1c1
Sequence:CCGGCAATGTGGATGCCTGTGTGATCTCGAGATCACACAGGCATCCACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-127s1c1
Sequence:CCGGAGGAGGCTTCTCTTTCGAGAACTCGAGTTCTCGAAAGAGAAGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013640.3-589s21c1
Sequence:CCGGCTGCGAGAAGATCCACTTCATCTCGAGATGAAGTGGATCTTCTCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013640.3-554s21c1
Sequence:CCGGCGGGCCACTAACGATTCGGTTCTCGAGAACCGAATCGTTAGTGGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013640
PSMB10 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013640.3-1012s21c1
Sequence:CCGGCAATGTGGATGCCTGTGTGATCTCGAGATCACACAGGCATCCACATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013640.3-409s21c1
Sequence:CCGGAGGAGGCTTCTCTTTCGAGAACTCGAGTTCTCGAAAGAGAAGCCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-395s1c1
Sequence:CCGGGCTTCCAAGATGGAACTACATCTCGAGATGTAGTTCCATCTTGGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-307s1c1
Sequence:CCGGCTGCGAGAAGATCCACTTCATCTCGAGATGAAGTGGATCTTCTCGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-272s1c1
Sequence:CCGGCGGGCCACTAACGATTCGGTTCTCGAGAACCGAATCGTTAGTGGCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-730s1c1
Sequence:CCGGCAATGTGGATGCCTGTGTGATCTCGAGATCACACAGGCATCCACATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013640.1-127s1c1
Sequence:CCGGAGGAGGCTTCTCTTTCGAGAACTCGAGTTCTCGAAAGAGAAGCCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013640.3-589s21c1
Sequence:CCGGCTGCGAGAAGATCCACTTCATCTCGAGATGAAGTGGATCTTCTCGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013640.3-554s21c1
Sequence:CCGGCGGGCCACTAACGATTCGGTTCTCGAGAACCGAATCGTTAGTGGCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)