EMAIL THIS PAGE TO A FRIEND

PSMB11

proteasome (prosome, macropain) subunit, beta type, 11

52 Gene Product Result for
Synonyms: BETA5T
UniProtKB ID: A5LHX3
Gene ID:
Human(122706) Summary: Proteasomes generate peptides that are presented by major histocompatibility complex (MHC) I molecules to other cells of the immune system. Proteolysis is conducted by 20S proteasomes, complexes of 28 subunits arranged as a cylinder in 4 heteroheptameric rings: alpha-1 to -7, beta-1 to -7, beta-1 to -7, and alpha-1 to -7. The catalytic subunits are beta-1 (PSMB6; MIM 600307), beta-2 (PSMB7; MIM 604030), and beta-5 (PSMB5; MIM 600306). Three additional subunits, beta-1i (PSMB9; MIM 177045), beta-2i (PSMB10; MIM 176847), and beta-5i (PSMB8; MIM 177046), are induced by gamma-interferon (IFNG; MIM 147570) and are preferentially incorporated into proteasomes to make immunoproteasomes. PSMB11, or beta-5t, is a catalytic subunit expressed exclusively in cortical thymic epithelial cells (Murata et al., 2007 [PubMed 17540904]
Mouse(73902) proteasome (prosome, macropain) subunit, beta type, 11
Rat(290206) proteasome (prosome, macropain) subunit, beta type, 11
Zebrafish(64279) proteasome (prosome, macropain) subunit, beta type, 11
dog(490604) proteasome (prosome, macropain) subunit, beta type, 11
domestic cat(101095263) proteasome (prosome, macropain) subunit, beta type, 11
cow(538873) proteasome (prosome, macropain) subunit, beta type, 11
sheep(101122952) proteasome (prosome, macropain) subunit, beta type, 11
naked mole-rat(101708621) proteasome (prosome, macropain) subunit, beta type, 11
domestic guinea pig(100718045) proteasome (prosome, macropain) subunit, beta type, 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099780 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099780 Rosetta Predictions human pricing
XM_063287 Rosetta Predictions human pricing
NM_001106032 Rosetta Predictions rat pricing
NM_175204 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321418 predicted 530
2 SASI_Hs02_00321419 predicted 619
3 SASI_Hs02_00321420 predicted 942
4 SASI_Hs02_00321421 predicted 442
5 SASI_Hs02_00321422 predicted 599
6 SASI_Hs02_00321423 predicted 452
7 SASI_Hs02_00321424 predicted 771
8 SASI_Hs02_00321425 predicted 941
9 SASI_Hs02_00321426 predicted 354
10 SASI_Hs02_00321427 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_063287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260457 predicted 949
2 SASI_Hs01_00260458 predicted 935
3 SASI_Hs01_00260459 predicted 934
4 SASI_Hs01_00260460 predicted 943
5 SASI_Hs01_00260461 predicted 911
6 SASI_Hs01_00260462 predicted 943
7 SASI_Hs01_00260463 predicted 950
8 SASI_Hs01_00260464 predicted 928
9 SASI_Hs01_00260465 predicted 1118
10 SASI_Hs01_00260466 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214952 predicted 447
2 SASI_Rn02_00214953 predicted 842
3 SASI_Rn02_00214954 predicted 955
4 SASI_Rn02_00214955 predicted 610
5 SASI_Rn02_00214956 predicted 243
6 SASI_Rn02_00214957 predicted 818
7 SASI_Rn02_00214958 predicted 456
8 SASI_Rn02_00214959 predicted 356
9 SASI_Rn02_00214960 predicted 768
10 SASI_Rn02_00214961 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345867 predicted 1145
2 SASI_Mm02_00345868 predicted 1318
3 SASI_Mm02_00345869 predicted 873
4 SASI_Mm02_00345870 predicted 514
5 SASI_Mm02_00345871 predicted 411
6 SASI_Mm02_00345872 predicted 1089
7 SASI_Mm02_00345873 predicted 1382
8 SASI_Mm02_00345874 predicted 1132
9 SASI_Mm02_00345875 predicted 1168
10 SASI_Mm02_00345876 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099780
PSMB11 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099780.1-455s21c1
Sequence:CCGGGTCAGCCATGATGTCTCAATACTCGAGTATTGAGACATCATGGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099780.1-1114s21c1
Sequence:CCGGATGACTCCCAGAGCTATTATGCTCGAGCATAATAGCTCTGGGAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099780.1-532s21c1
Sequence:CCGGCTGAGCTCTTCTACGTCTATACTCGAGTATAGACGTAGAAGAGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099780.1-226s21c1
Sequence:CCGGGCTTCCGTCATGGAGTCATTGCTCGAGCAATGACTCCATGACGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099780.1-363s21c1
Sequence:CCGGGCTACCTGGTATCGGGTATTACTCGAGTAATACCCGATACCAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099780
PSMB11 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099780.1-455s21c1
Sequence:CCGGGTCAGCCATGATGTCTCAATACTCGAGTATTGAGACATCATGGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099780.1-1114s21c1
Sequence:CCGGATGACTCCCAGAGCTATTATGCTCGAGCATAATAGCTCTGGGAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099780.1-532s21c1
Sequence:CCGGCTGAGCTCTTCTACGTCTATACTCGAGTATAGACGTAGAAGAGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099780.1-226s21c1
Sequence:CCGGGCTTCCGTCATGGAGTCATTGCTCGAGCAATGACTCCATGACGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099780.1-363s21c1
Sequence:CCGGGCTACCTGGTATCGGGTATTACTCGAGTAATACCCGATACCAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099780
PSMB11 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099780.1-455s21c1
Sequence:CCGGGTCAGCCATGATGTCTCAATACTCGAGTATTGAGACATCATGGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099780.1-1114s21c1
Sequence:CCGGATGACTCCCAGAGCTATTATGCTCGAGCATAATAGCTCTGGGAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099780.1-532s21c1
Sequence:CCGGCTGAGCTCTTCTACGTCTATACTCGAGTATAGACGTAGAAGAGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099780.1-226s21c1
Sequence:CCGGGCTTCCGTCATGGAGTCATTGCTCGAGCAATGACTCCATGACGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099780.1-363s21c1
Sequence:CCGGGCTACCTGGTATCGGGTATTACTCGAGTAATACCCGATACCAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175204
PSMB11 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175204.2-895s1c1
Sequence:CCGGGCGATAATAATGAAGACTGAACTCGAGTTCAGTCTTCATTATTATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175204.2-841s1c1
Sequence:CCGGCGAGAATGTAAAGAACTCTTTCTCGAGAAAGAGTTCTTTACATTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175204.2-2515s1c1
Sequence:CCGGCCAGGGTAGAAATCTGGCTATCTCGAGATAGCCAGATTTCTACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175204.2-493s1c1
Sequence:CCGGCTCTTCTATGTCTACAGCGATCTCGAGATCGCTGTAGACATAGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175204.2-715s1c1
Sequence:CCGGGAGTATGTATCCCGCAGTGATCTCGAGATCACTGCGGGATACATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175204
PSMB11 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175204.2-895s1c1
Sequence:CCGGGCGATAATAATGAAGACTGAACTCGAGTTCAGTCTTCATTATTATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175204.2-841s1c1
Sequence:CCGGCGAGAATGTAAAGAACTCTTTCTCGAGAAAGAGTTCTTTACATTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175204.2-2515s1c1
Sequence:CCGGCCAGGGTAGAAATCTGGCTATCTCGAGATAGCCAGATTTCTACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175204.2-493s1c1
Sequence:CCGGCTCTTCTATGTCTACAGCGATCTCGAGATCGCTGTAGACATAGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175204.2-715s1c1
Sequence:CCGGGAGTATGTATCCCGCAGTGATCTCGAGATCACTGCGGGATACATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175204
PSMB11 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175204.2-895s1c1
Sequence:CCGGGCGATAATAATGAAGACTGAACTCGAGTTCAGTCTTCATTATTATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175204.2-841s1c1
Sequence:CCGGCGAGAATGTAAAGAACTCTTTCTCGAGAAAGAGTTCTTTACATTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175204.2-2515s1c1
Sequence:CCGGCCAGGGTAGAAATCTGGCTATCTCGAGATAGCCAGATTTCTACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175204.2-493s1c1
Sequence:CCGGCTCTTCTATGTCTACAGCGATCTCGAGATCGCTGTAGACATAGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175204.2-715s1c1
Sequence:CCGGGAGTATGTATCCCGCAGTGATCTCGAGATCACTGCGGGATACATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)