EMAIL THIS PAGE TO A FRIEND

PSMB1

proteasome (prosome, macropain) subunit, beta type, 1

54 Gene Product Result for
Synonyms: HC5 PMSB1 PSC5
UniProtKB ID: P20618, B5BU76, Q9BWA8
Gene ID:
Human(5689) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is tightly linked to the TBP (TATA-binding protein) gene in human and in mouse, and is transcribed in the opposite orientation in both species. [provided by RefSeq, Jul 2008]
Mouse(19170) proteasome (prosome, macropain) subunit, beta type 1
Rat(94198) proteasome (prosome, macropain) subunit, beta type 1
Zebrafish(445413) proteasome (prosome, macropain) subunit, beta type, 1
domestic cat(101101060) proteasome (prosome, macropain) subunit, beta type, 1
dog(475040) proteasome (prosome, macropain) subunit, beta type, 1
chicken(421551) proteasome (prosome, macropain) subunit, beta type, 1
cow(514237) proteasome (prosome, macropain) subunit, beta type, 1
sheep(101116408) proteasome (prosome, macropain) subunit, beta type, 1
naked mole-rat(101701261) proteasome (prosome, macropain) subunit, beta type, 1
domestic guinea pig(100734982) proteasome (prosome, macropain) subunit, beta type, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002793 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002793 Rosetta Predictions human pricing
NM_053590 Rosetta Predictions rat pricing
NM_011185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176491 predicted 308
2 SASI_Hs01_00176492 predicted 341
3 SASI_Hs02_00334447 predicted 502
4 SASI_Hs01_00176494 predicted 415
5 SASI_Hs01_00176495 predicted 281
6 SASI_Hs02_00334448 predicted 305
7 SASI_Hs01_00176498 predicted 451
8 SASI_Hs02_00334449 predicted 395
9 SASI_Hs02_00334450 predicted 337
10 SASI_Hs02_00334451 predicted 592
11 SASI_Hs01_00176490 predicted 392
12 SASI_Hs01_00176493 predicted 545
13 SASI_Hs01_00176496 predicted 440
14 SASI_Hs01_00176497 predicted 349
15 SASI_Hs01_00176499 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076872 predicted 422
2 SASI_Rn02_00266260 predicted 275
3 SASI_Rn01_00076873 predicted 385
4 SASI_Rn01_00076874 predicted 451
5 SASI_Rn01_00076876 predicted 353
6 SASI_Rn01_00076877 predicted 248
7 SASI_Rn01_00076878 predicted 275
8 SASI_Rn01_00076879 predicted 316
9 SASI_Rn01_00076880 predicted 476
10 SASI_Rn01_00076881 predicted 310
11 SASI_Rn01_00076875 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320077 predicted 675
2 SASI_Mm01_00171680 predicted 219
3 SASI_Mm01_00171686 predicted 421
4 SASI_Mm02_00320078 predicted 270
5 SASI_Mm02_00320079 predicted 249
6 SASI_Mm02_00320080 predicted 232
7 SASI_Mm01_00171683 predicted 299
8 SASI_Mm02_00320081 predicted 614
9 SASI_Mm01_00171688 predicted 289
10 SASI_Mm02_00320082 predicted 595
11 SASI_Mm01_00171679 predicted 544
12 SASI_Mm01_00171681 predicted 230
13 SASI_Mm01_00171682 predicted 321
14 SASI_Mm01_00171684 predicted 217
15 SASI_Mm01_00171685 predicted 405
16 SASI_Mm01_00171687 predicted 255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011185
VALIDATED
PSMB1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-355s21c1
Sequence:CCGGCGATTGCTGCAATGCTGTCTACTCGAGTAGACAGCATTGCAGCAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-266s21c1
Sequence:CCGGCCATGGAGATTGTCTCACTTTCTCGAGAAAGTGAGACAATCTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-270s1c1
Sequence:CCGGCCATGGAGATTGTCTCACTTTCTCGAGAAAGTGAGACAATCTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-359s1c1
Sequence:CCGGCGATTGCTGCAATGCTGTCTACTCGAGTAGACAGCATTGCAGCAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-123s1c1
Sequence:CCGGCGGAGGTACTGTATTGGCAATCTCGAGATTGCCAATACAGTACCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-405s1c1
Sequence:CCGGCCCTTACTATGTTTACAACATCTCGAGATGTTGTAAACATAGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-327s1c1
Sequence:CCGGGCATTCCAATAACAAGGCCATCTCGAGATGGCCTTGTTATTGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-119s21c1
Sequence:CCGGCGGAGGTACTGTATTGGCAATCTCGAGATTGCCAATACAGTACCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-401s21c1
Sequence:CCGGCCCTTACTATGTTTACAACATCTCGAGATGTTGTAAACATAGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-323s21c1
Sequence:CCGGGCATTCCAATAACAAGGCCATCTCGAGATGGCCTTGTTATTGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011185
VALIDATED
PSMB1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-355s21c1
Sequence:CCGGCGATTGCTGCAATGCTGTCTACTCGAGTAGACAGCATTGCAGCAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-266s21c1
Sequence:CCGGCCATGGAGATTGTCTCACTTTCTCGAGAAAGTGAGACAATCTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-270s1c1
Sequence:CCGGCCATGGAGATTGTCTCACTTTCTCGAGAAAGTGAGACAATCTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-359s1c1
Sequence:CCGGCGATTGCTGCAATGCTGTCTACTCGAGTAGACAGCATTGCAGCAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-123s1c1
Sequence:CCGGCGGAGGTACTGTATTGGCAATCTCGAGATTGCCAATACAGTACCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-405s1c1
Sequence:CCGGCCCTTACTATGTTTACAACATCTCGAGATGTTGTAAACATAGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-327s1c1
Sequence:CCGGGCATTCCAATAACAAGGCCATCTCGAGATGGCCTTGTTATTGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-119s21c1
Sequence:CCGGCGGAGGTACTGTATTGGCAATCTCGAGATTGCCAATACAGTACCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-401s21c1
Sequence:CCGGCCCTTACTATGTTTACAACATCTCGAGATGTTGTAAACATAGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-323s21c1
Sequence:CCGGGCATTCCAATAACAAGGCCATCTCGAGATGGCCTTGTTATTGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011185
VALIDATED
PSMB1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-355s21c1
Sequence:CCGGCGATTGCTGCAATGCTGTCTACTCGAGTAGACAGCATTGCAGCAATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-266s21c1
Sequence:CCGGCCATGGAGATTGTCTCACTTTCTCGAGAAAGTGAGACAATCTCCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-270s1c1
Sequence:CCGGCCATGGAGATTGTCTCACTTTCTCGAGAAAGTGAGACAATCTCCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-359s1c1
Sequence:CCGGCGATTGCTGCAATGCTGTCTACTCGAGTAGACAGCATTGCAGCAATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-123s1c1
Sequence:CCGGCGGAGGTACTGTATTGGCAATCTCGAGATTGCCAATACAGTACCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-405s1c1
Sequence:CCGGCCCTTACTATGTTTACAACATCTCGAGATGTTGTAAACATAGTAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011185.1-327s1c1
Sequence:CCGGGCATTCCAATAACAAGGCCATCTCGAGATGGCCTTGTTATTGGAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-119s21c1
Sequence:CCGGCGGAGGTACTGTATTGGCAATCTCGAGATTGCCAATACAGTACCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-401s21c1
Sequence:CCGGCCCTTACTATGTTTACAACATCTCGAGATGTTGTAAACATAGTAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011185.3-323s21c1
Sequence:CCGGGCATTCCAATAACAAGGCCATCTCGAGATGGCCTTGTTATTGGAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002793
VALIDATED
PSMB1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002793.3-820s21c1
Sequence:CCGGTGCTCTTATCACCAATCAGTTCTCGAGAACTGATTGGTGATAAGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002793.3-751s21c1
Sequence:CCGGCGGATCTGCATAGTGACCAAACTCGAGTTTGGTCACTATGCAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_002793.3-376s21c1
Sequence:CCGGGAAGCAAGACTAAAGATGTATCTCGAGATACATCTTTAGTCTTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002793.x-336s1c1
Sequence:CCGGGAAGCAAGACTAAAGATGTATCTCGAGATACATCTTTAGTCTTGCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002793.x-711s1c1
Sequence:CCGGCGGATCTGCATAGTGACCAAACTCGAGTTTGGTCACTATGCAGATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002793.x-647s1c1
Sequence:CCGGGCGGCTGGTGAAAGATGTCTTCTCGAGAAGACATCTTTCACCAGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002793.x-499s1c1
Sequence:CCGGGCTTTGATCCAGTAGGGTCTTCTCGAGAAGACCCTACTGGATCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002793.x-780s1c1
Sequence:CCGGTGCTCTTATCACCAATCAGTTCTCGAGAACTGATTGGTGATAAGAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002793.3-539s21c1
Sequence:CCGGGCTTTGATCCAGTAGGGTCTTCTCGAGAAGACCCTACTGGATCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002793
VALIDATED
PSMB1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002793.3-820s21c1
Sequence:CCGGTGCTCTTATCACCAATCAGTTCTCGAGAACTGATTGGTGATAAGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002793.3-751s21c1
Sequence:CCGGCGGATCTGCATAGTGACCAAACTCGAGTTTGGTCACTATGCAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_002793.3-376s21c1
Sequence:CCGGGAAGCAAGACTAAAGATGTATCTCGAGATACATCTTTAGTCTTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002793.x-336s1c1
Sequence:CCGGGAAGCAAGACTAAAGATGTATCTCGAGATACATCTTTAGTCTTGCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002793.x-711s1c1
Sequence:CCGGCGGATCTGCATAGTGACCAAACTCGAGTTTGGTCACTATGCAGATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002793.x-647s1c1
Sequence:CCGGGCGGCTGGTGAAAGATGTCTTCTCGAGAAGACATCTTTCACCAGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002793.x-499s1c1
Sequence:CCGGGCTTTGATCCAGTAGGGTCTTCTCGAGAAGACCCTACTGGATCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002793.x-780s1c1
Sequence:CCGGTGCTCTTATCACCAATCAGTTCTCGAGAACTGATTGGTGATAAGAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002793.3-539s21c1
Sequence:CCGGGCTTTGATCCAGTAGGGTCTTCTCGAGAAGACCCTACTGGATCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002793
VALIDATED
PSMB1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002793.3-820s21c1
Sequence:CCGGTGCTCTTATCACCAATCAGTTCTCGAGAACTGATTGGTGATAAGAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002793.3-751s21c1
Sequence:CCGGCGGATCTGCATAGTGACCAAACTCGAGTTTGGTCACTATGCAGATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_002793.3-376s21c1
Sequence:CCGGGAAGCAAGACTAAAGATGTATCTCGAGATACATCTTTAGTCTTGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002793.x-336s1c1
Sequence:CCGGGAAGCAAGACTAAAGATGTATCTCGAGATACATCTTTAGTCTTGCTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002793.x-711s1c1
Sequence:CCGGCGGATCTGCATAGTGACCAAACTCGAGTTTGGTCACTATGCAGATCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002793.x-647s1c1
Sequence:CCGGGCGGCTGGTGAAAGATGTCTTCTCGAGAAGACATCTTTCACCAGCCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002793.x-499s1c1
Sequence:CCGGGCTTTGATCCAGTAGGGTCTTCTCGAGAAGACCCTACTGGATCAAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002793.x-780s1c1
Sequence:CCGGTGCTCTTATCACCAATCAGTTCTCGAGAACTGATTGGTGATAAGAGCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002793.3-539s21c1
Sequence:CCGGGCTTTGATCCAGTAGGGTCTTCTCGAGAAGACCCTACTGGATCAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)