EMAIL THIS PAGE TO A FRIEND

PSMB2

proteasome (prosome, macropain) subunit, beta type, 2

92 Gene Product Result for
Synonyms: HC7-I
UniProtKB ID: P49721, D3DPS0, P31145, Q9BWZ9
Gene ID:
Human(5690) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Mouse(26445) proteasome (prosome, macropain) subunit, beta type 2
Rat(29675) proteasome (prosome, macropain) subunit, beta type 2
Zebrafish(436882) proteasome (prosome, macropain) subunit, beta type, 2
domestic cat(101086664) proteasome (prosome, macropain) subunit, beta type, 2
dog(475338) proteasome (prosome, macropain) subunit, beta type, 2
chicken(419630) proteasome (prosome, macropain) subunit, beta type, 2
domestic guinea pig(100734726) proteasome (prosome, macropain) subunit, beta type, 2
naked mole-rat(101712502) proteasome (prosome, macropain) subunit, beta type, 2
cow(516919) proteasome (prosome, macropain) subunit, beta type, 2
sheep(101110188) proteasome (prosome, macropain) subunit, beta type, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011970 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011970 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011970 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002794 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002794 Rosetta Predictions human pricing
NM_017284 Rosetta Predictions rat pricing
NM_011970 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235807 predicted 301
2 SASI_Hs02_00334452 predicted 292
3 SASI_Hs01_00235808 predicted 421
4 SASI_Hs01_00235809 predicted 526
5 SASI_Hs01_00235810 predicted 357
6 SASI_Hs01_00235811 predicted 206
7 SASI_Hs01_00235812 predicted 309
8 SASI_Hs01_00235814 predicted 231
9 SASI_Hs01_00235815 predicted 312
10 SASI_Hs01_00235816 predicted 398
11 SASI_Hs01_00235813 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105403 predicted 394
2 SASI_Rn01_00105404 predicted 475
3 SASI_Rn01_00105405 predicted 210
4 SASI_Rn01_00105406 predicted 368
5 SASI_Rn01_00105407 predicted 315
6 SASI_Rn02_00261706 predicted 218
7 SASI_Rn01_00105408 predicted 315
8 SASI_Rn01_00105409 predicted 308
9 SASI_Rn01_00105410 predicted 340
10 SASI_Rn01_00105411 predicted 362
11 SASI_Rn01_00105412 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011970 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321858 predicted 420
2 SASI_Mm01_00021964 predicted 292
3 SASI_Mm01_00021965 predicted 396
4 SASI_Mm01_00021966 predicted 480
5 SASI_Mm02_00321859 predicted 494
6 SASI_Mm02_00321860 predicted 510
7 SASI_Mm01_00021967 predicted 413
8 SASI_Mm01_00021968 predicted 296
9 SASI_Mm01_00021971 predicted 481
10 SASI_Mm02_00321861 predicted 490
11 SASI_Mm01_00021969 predicted 259
12 SASI_Mm01_00021970 predicted 353
13 SASI_Mm01_00021972 predicted 379
14 SASI_Mm01_00021973 predicted 505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011970
VALIDATED
PSMB2 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-650s21c1
Sequence:CCGGGTCCGGGTCATTGACAAAGATCTCGAGATCTTTGTCAATGACCCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-202s21c1
Sequence:CCGGCGATCATGACAAGATGTTTAACTCGAGTTAAACATCTTGTCATGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011970.2-523s1c1
Sequence:CCGGCCGATACTACACACCTACCATCTCGAGATGGTAGGTGTGTAGTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011970.2-154s1c1
Sequence:CCGGCGCCAGCAATATTGTCCAGATCTCGAGATCTGGACAATATTGCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011970.2-629s1c1
Sequence:CCGGGTCCGGGTCATTGACAAAGATCTCGAGATCTTTGTCAATGACCCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011970.2-404s1c1
Sequence:CCGGGCTGGCTATGACGAGCATGAACTCGAGTTCATGCTCGTCATAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011970.2-181s1c1
Sequence:CCGGCGATCATGACAAGATGTTTAACTCGAGTTAAACATCTTGTCATGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-544s21c1
Sequence:CCGGCCGATACTACACACCTACCATCTCGAGATGGTAGGTGTGTAGTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-271s21c1
Sequence:CCGGTGTACAGTTTGCAGAATATATCTCGAGATATATTCTGCAAACTGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-317s21c1
Sequence:CCGGATGCGGAATGGATATGAATTGCTCGAGCAATTCATATCCATTCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011970
VALIDATED
PSMB2 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-650s21c1
Sequence:CCGGGTCCGGGTCATTGACAAAGATCTCGAGATCTTTGTCAATGACCCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-202s21c1
Sequence:CCGGCGATCATGACAAGATGTTTAACTCGAGTTAAACATCTTGTCATGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011970.2-523s1c1
Sequence:CCGGCCGATACTACACACCTACCATCTCGAGATGGTAGGTGTGTAGTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011970.2-154s1c1
Sequence:CCGGCGCCAGCAATATTGTCCAGATCTCGAGATCTGGACAATATTGCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011970.2-629s1c1
Sequence:CCGGGTCCGGGTCATTGACAAAGATCTCGAGATCTTTGTCAATGACCCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011970.2-404s1c1
Sequence:CCGGGCTGGCTATGACGAGCATGAACTCGAGTTCATGCTCGTCATAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011970.2-181s1c1
Sequence:CCGGCGATCATGACAAGATGTTTAACTCGAGTTAAACATCTTGTCATGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-544s21c1
Sequence:CCGGCCGATACTACACACCTACCATCTCGAGATGGTAGGTGTGTAGTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-271s21c1
Sequence:CCGGTGTACAGTTTGCAGAATATATCTCGAGATATATTCTGCAAACTGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-317s21c1
Sequence:CCGGATGCGGAATGGATATGAATTGCTCGAGCAATTCATATCCATTCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011970
VALIDATED
PSMB2 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-650s21c1
Sequence:CCGGGTCCGGGTCATTGACAAAGATCTCGAGATCTTTGTCAATGACCCGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-202s21c1
Sequence:CCGGCGATCATGACAAGATGTTTAACTCGAGTTAAACATCTTGTCATGATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011970.2-523s1c1
Sequence:CCGGCCGATACTACACACCTACCATCTCGAGATGGTAGGTGTGTAGTATCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011970.2-154s1c1
Sequence:CCGGCGCCAGCAATATTGTCCAGATCTCGAGATCTGGACAATATTGCTGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011970.2-629s1c1
Sequence:CCGGGTCCGGGTCATTGACAAAGATCTCGAGATCTTTGTCAATGACCCGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011970.2-404s1c1
Sequence:CCGGGCTGGCTATGACGAGCATGAACTCGAGTTCATGCTCGTCATAGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011970.2-181s1c1
Sequence:CCGGCGATCATGACAAGATGTTTAACTCGAGTTAAACATCTTGTCATGATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-544s21c1
Sequence:CCGGCCGATACTACACACCTACCATCTCGAGATGGTAGGTGTGTAGTATCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-271s21c1
Sequence:CCGGTGTACAGTTTGCAGAATATATCTCGAGATATATTCTGCAAACTGTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011970.4-317s21c1
Sequence:CCGGATGCGGAATGGATATGAATTGCTCGAGCAATTCATATCCATTCCGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002794
VALIDATED
PSMB2 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-792s21c1
Sequence:CCGGCGCACTCTTGATAAATGGTTACTCGAGTAACCATTTATCAAGAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002794.x-456s1c1
Sequence:CCGGTATTACATGGACTACCTGGCACTCGAGTGCCAGGTAGTCCATGTAATATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002794.x-541s1c1
Sequence:CCGGACCGATACTACACACCGACTACTCGAGTAGTCGGTGTGTAGTATCGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002794.x-792s1c1
Sequence:CCGGCGCACTCTTGATAAATGGTTACTCGAGTAACCATTTATCAAGAGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-269s21c1
Sequence:CCGGTGTACAGTTTGCAGAATATATCTCGAGATATATTCTGCAAACTGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002794.x-348s1c1
Sequence:CCGGGCAGCTAACTTCACACGCCGACTCGAGTCGGCGTGTGAAGTTAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002794.x-313s1c1
Sequence:CCGGAGATGCGAAATGGATATGAATCTCGAGATTCATATCCATTTCGCATCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-673s21c1
Sequence:CCGGTCCATGACCTGGATAACATTTCTCGAGAAATGTTATCCAGGTCATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-541s21c1
Sequence:CCGGACCGATACTACACACCGACTACTCGAGTAGTCGGTGTGTAGTATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-313s21c1
Sequence:CCGGAGATGCGAAATGGATATGAATCTCGAGATTCATATCCATTTCGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002794
VALIDATED
PSMB2 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-792s21c1
Sequence:CCGGCGCACTCTTGATAAATGGTTACTCGAGTAACCATTTATCAAGAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002794.x-456s1c1
Sequence:CCGGTATTACATGGACTACCTGGCACTCGAGTGCCAGGTAGTCCATGTAATATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002794.x-541s1c1
Sequence:CCGGACCGATACTACACACCGACTACTCGAGTAGTCGGTGTGTAGTATCGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002794.x-792s1c1
Sequence:CCGGCGCACTCTTGATAAATGGTTACTCGAGTAACCATTTATCAAGAGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-269s21c1
Sequence:CCGGTGTACAGTTTGCAGAATATATCTCGAGATATATTCTGCAAACTGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002794.x-348s1c1
Sequence:CCGGGCAGCTAACTTCACACGCCGACTCGAGTCGGCGTGTGAAGTTAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002794.x-313s1c1
Sequence:CCGGAGATGCGAAATGGATATGAATCTCGAGATTCATATCCATTTCGCATCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-673s21c1
Sequence:CCGGTCCATGACCTGGATAACATTTCTCGAGAAATGTTATCCAGGTCATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-541s21c1
Sequence:CCGGACCGATACTACACACCGACTACTCGAGTAGTCGGTGTGTAGTATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-313s21c1
Sequence:CCGGAGATGCGAAATGGATATGAATCTCGAGATTCATATCCATTTCGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002794
VALIDATED
PSMB2 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-792s21c1
Sequence:CCGGCGCACTCTTGATAAATGGTTACTCGAGTAACCATTTATCAAGAGTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002794.x-456s1c1
Sequence:CCGGTATTACATGGACTACCTGGCACTCGAGTGCCAGGTAGTCCATGTAATATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002794.x-541s1c1
Sequence:CCGGACCGATACTACACACCGACTACTCGAGTAGTCGGTGTGTAGTATCGGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002794.x-792s1c1
Sequence:CCGGCGCACTCTTGATAAATGGTTACTCGAGTAACCATTTATCAAGAGTGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-269s21c1
Sequence:CCGGTGTACAGTTTGCAGAATATATCTCGAGATATATTCTGCAAACTGTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002794.x-348s1c1
Sequence:CCGGGCAGCTAACTTCACACGCCGACTCGAGTCGGCGTGTGAAGTTAGCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002794.x-313s1c1
Sequence:CCGGAGATGCGAAATGGATATGAATCTCGAGATTCATATCCATTTCGCATCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-673s21c1
Sequence:CCGGTCCATGACCTGGATAACATTTCTCGAGAAATGTTATCCAGGTCATGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-541s21c1
Sequence:CCGGACCGATACTACACACCGACTACTCGAGTAGTCGGTGTGTAGTATCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002794.3-313s21c1
Sequence:CCGGAGATGCGAAATGGATATGAATCTCGAGATTCATATCCATTTCGCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)