EMAIL THIS PAGE TO A FRIEND

PSMB3

proteasome (prosome, macropain) subunit, beta type, 3

52 Gene Product Result for
Synonyms: HC10-II
UniProtKB ID: P49720, P31147, Q0P6J7, Q96E27
Gene ID:
Human(5691) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. Pseudogenes have been identified on chromosomes 2 and 12. [provided by RefSeq, Jul 2008]
Mouse(26446) proteasome (prosome, macropain) subunit, beta type 3
Rat(29676) proteasome (prosome, macropain) subunit, beta type 3
cow(533874) proteasome (prosome, macropain) subunit, beta type, 3
sheep(101120589) proteasome (prosome, macropain) subunit, beta type, 3
naked mole-rat(101720602) proteasome (prosome, macropain) subunit, beta type, 3
domestic guinea pig(100719768) proteasome (prosome, macropain) subunit, beta type, 3
Zebrafish(573095) proteasome (prosome, macropain) subunit, beta type, 3
domestic cat(101087282) proteasome (prosome, macropain) subunit, beta type, 3
dog(480537) proteasome (prosome, macropain) subunit, beta type, 3
chicken(419997) proteasome (prosome, macropain) subunit, beta type, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002795 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011971 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011971 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011971 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002795 Rosetta Predictions human pricing
NM_017285 Rosetta Predictions rat pricing
NM_011971 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216057 predicted 417
2 SASI_Hs01_00216059 predicted 326
3 SASI_Hs01_00216060 predicted 376
4 SASI_Hs01_00216061 predicted 349
5 SASI_Hs02_00334453 predicted 401
6 SASI_Hs01_00216062 predicted 285
7 SASI_Hs01_00216063 predicted 315
8 SASI_Hs01_00216064 predicted 254
9 SASI_Hs01_00216065 predicted 281
10 SASI_Hs01_00216066 predicted 259
11 SASI_Hs01_00216058 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065854 predicted 546
2 SASI_Rn02_00261707 predicted 465
3 SASI_Rn02_00261708 predicted 272
4 SASI_Rn02_00261709 predicted 350
5 SASI_Rn01_00065855 predicted 409
6 SASI_Rn01_00065856 predicted 324
7 SASI_Rn02_00261710 predicted 254
8 SASI_Rn01_00065857 predicted 502
9 SASI_Rn02_00261711 predicted 559
10 SASI_Rn02_00261712 predicted 562
11 SASI_Rn01_00065858 predicted 410
12 SASI_Rn01_00065859 predicted 499
13 SASI_Rn01_00065860 predicted 413
14 SASI_Rn01_00065861 predicted 680
15 SASI_Rn01_00065862 predicted 771
16 SASI_Rn01_00065863 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155344 predicted 260
2 SASI_Mm01_00155345 predicted 287
3 SASI_Mm02_00321862 predicted 295
4 SASI_Mm01_00155343 predicted 258
5 SASI_Mm02_00321863 predicted 235
6 SASI_Mm02_00321864 predicted 477
7 SASI_Mm01_00155347 predicted 216
8 SASI_Mm02_00321865 predicted 244
9 SASI_Mm02_00321866 predicted 434
10 SASI_Mm02_00321867 predicted 246
11 SASI_Mm01_00155346 predicted 261
12 SASI_Mm01_00155348 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002795
VALIDATED
PSMB3 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-303s21c1
Sequence:CCGGGTTGAAGGAAGGTCGGCAGATCTCGAGATCTGCCGACCTTCCTTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-295s21c1
Sequence:CCGGCTGTATGAGTTGAAGGAAGGTCTCGAGACCTTCCTTCAACTCATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-314s21c1
Sequence:CCGGGTCGGCAGATCAAACCTTATACTCGAGTATAAGGTTTGATCTGCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002795.x-498s1c1
Sequence:CCGGCACCTGCGCCGAACAAATGTACTCGAGTACATTTGTTCGGCGCAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002795.x-303s1c1
Sequence:CCGGGTTGAAGGAAGGTCGGCAGATCTCGAGATCTGCCGACCTTCCTTCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-353s21c1
Sequence:CCGGCCAACCTCTTGTATGAGAAACCTCGAGGTTTCTCATACAAGAGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-411s21c1
Sequence:CCGGGTTGGACCCGAAGACCTTTAACTCGAGTTAAAGGTCTTCGGGTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002795.x-295s1c1
Sequence:CCGGCTGTATGAGTTGAAGGAAGGTCTCGAGACCTTCCTTCAACTCATACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002795.x-314s1c1
Sequence:CCGGGTCGGCAGATCAAACCTTATACTCGAGTATAAGGTTTGATCTGCCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002795.x-321s1c1
Sequence:CCGGGATCAAACCTTATACCCTCATCTCGAGATGAGGGTATAAGGTTTGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002795
VALIDATED
PSMB3 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-303s21c1
Sequence:CCGGGTTGAAGGAAGGTCGGCAGATCTCGAGATCTGCCGACCTTCCTTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-295s21c1
Sequence:CCGGCTGTATGAGTTGAAGGAAGGTCTCGAGACCTTCCTTCAACTCATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-314s21c1
Sequence:CCGGGTCGGCAGATCAAACCTTATACTCGAGTATAAGGTTTGATCTGCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002795.x-498s1c1
Sequence:CCGGCACCTGCGCCGAACAAATGTACTCGAGTACATTTGTTCGGCGCAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002795.x-303s1c1
Sequence:CCGGGTTGAAGGAAGGTCGGCAGATCTCGAGATCTGCCGACCTTCCTTCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-353s21c1
Sequence:CCGGCCAACCTCTTGTATGAGAAACCTCGAGGTTTCTCATACAAGAGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-411s21c1
Sequence:CCGGGTTGGACCCGAAGACCTTTAACTCGAGTTAAAGGTCTTCGGGTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002795.x-295s1c1
Sequence:CCGGCTGTATGAGTTGAAGGAAGGTCTCGAGACCTTCCTTCAACTCATACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002795.x-314s1c1
Sequence:CCGGGTCGGCAGATCAAACCTTATACTCGAGTATAAGGTTTGATCTGCCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002795.x-321s1c1
Sequence:CCGGGATCAAACCTTATACCCTCATCTCGAGATGAGGGTATAAGGTTTGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002795
VALIDATED
PSMB3 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-303s21c1
Sequence:CCGGGTTGAAGGAAGGTCGGCAGATCTCGAGATCTGCCGACCTTCCTTCAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-295s21c1
Sequence:CCGGCTGTATGAGTTGAAGGAAGGTCTCGAGACCTTCCTTCAACTCATACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-314s21c1
Sequence:CCGGGTCGGCAGATCAAACCTTATACTCGAGTATAAGGTTTGATCTGCCGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002795.x-498s1c1
Sequence:CCGGCACCTGCGCCGAACAAATGTACTCGAGTACATTTGTTCGGCGCAGGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002795.x-303s1c1
Sequence:CCGGGTTGAAGGAAGGTCGGCAGATCTCGAGATCTGCCGACCTTCCTTCAACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-353s21c1
Sequence:CCGGCCAACCTCTTGTATGAGAAACCTCGAGGTTTCTCATACAAGAGGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002795.2-411s21c1
Sequence:CCGGGTTGGACCCGAAGACCTTTAACTCGAGTTAAAGGTCTTCGGGTCCAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002795.x-295s1c1
Sequence:CCGGCTGTATGAGTTGAAGGAAGGTCTCGAGACCTTCCTTCAACTCATACAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002795.x-314s1c1
Sequence:CCGGGTCGGCAGATCAAACCTTATACTCGAGTATAAGGTTTGATCTGCCGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002795.x-321s1c1
Sequence:CCGGGATCAAACCTTATACCCTCATCTCGAGATGAGGGTATAAGGTTTGATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011971
VALIDATED
PSMB3 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011971.4-396s21c1
Sequence:CCGGGAAGACCTTCAAGCCCTTCATCTCGAGATGAAGGGCTTGAAGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011971.4-535s21c1
Sequence:CCGGGAACACCTGTTTGAAACCATTCTCGAGAATGGTTTCAAACAGGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011971.4-443s21c1
Sequence:CCGGCCATGGTGACTGATGACTTTGCTCGAGCAAAGTCATCAGTCACCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011971.2-536s1c1
Sequence:CCGGGAACACCTGTTTGAAACCATTCTCGAGAATGGTTTCAAACAGGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011971.2-397s1c1
Sequence:CCGGGAAGACCTTCAAGCCCTTCATCTCGAGATGAAGGGCTTGAAGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011971.2-481s1c1
Sequence:CCGGCTCCGAACAAATGTATGGGATCTCGAGATCCCATACATTTGTTCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011971.2-250s1c1
Sequence:CCGGGCGTCTCAAGTTCCGACTGAACTCGAGTTCAGTCGGAACTTGAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011971.4-164s21c1
Sequence:CCGGCGGACTTCCAGAAGATCTTTCCTCGAGGAAAGATCTTCTGGAAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011971.2-266s1c1
Sequence:CCGGCTGAACTTGTATGAGCTGAAACTCGAGTTTCAGCTCATACAAGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011971.4-118s21c1
Sequence:CCGGATCGCTGCAGACAGACGTTTCCTCGAGGAAACGTCTGTCTGCAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011971
VALIDATED
PSMB3 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011971.4-396s21c1
Sequence:CCGGGAAGACCTTCAAGCCCTTCATCTCGAGATGAAGGGCTTGAAGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011971.4-535s21c1
Sequence:CCGGGAACACCTGTTTGAAACCATTCTCGAGAATGGTTTCAAACAGGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011971.4-443s21c1
Sequence:CCGGCCATGGTGACTGATGACTTTGCTCGAGCAAAGTCATCAGTCACCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011971.2-536s1c1
Sequence:CCGGGAACACCTGTTTGAAACCATTCTCGAGAATGGTTTCAAACAGGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011971.2-397s1c1
Sequence:CCGGGAAGACCTTCAAGCCCTTCATCTCGAGATGAAGGGCTTGAAGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011971.2-481s1c1
Sequence:CCGGCTCCGAACAAATGTATGGGATCTCGAGATCCCATACATTTGTTCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011971.2-250s1c1
Sequence:CCGGGCGTCTCAAGTTCCGACTGAACTCGAGTTCAGTCGGAACTTGAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011971.4-164s21c1
Sequence:CCGGCGGACTTCCAGAAGATCTTTCCTCGAGGAAAGATCTTCTGGAAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011971.2-266s1c1
Sequence:CCGGCTGAACTTGTATGAGCTGAAACTCGAGTTTCAGCTCATACAAGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011971.4-118s21c1
Sequence:CCGGATCGCTGCAGACAGACGTTTCCTCGAGGAAACGTCTGTCTGCAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011971
VALIDATED
PSMB3 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011971.4-396s21c1
Sequence:CCGGGAAGACCTTCAAGCCCTTCATCTCGAGATGAAGGGCTTGAAGGTCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011971.4-535s21c1
Sequence:CCGGGAACACCTGTTTGAAACCATTCTCGAGAATGGTTTCAAACAGGTGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011971.4-443s21c1
Sequence:CCGGCCATGGTGACTGATGACTTTGCTCGAGCAAAGTCATCAGTCACCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011971.2-536s1c1
Sequence:CCGGGAACACCTGTTTGAAACCATTCTCGAGAATGGTTTCAAACAGGTGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011971.2-397s1c1
Sequence:CCGGGAAGACCTTCAAGCCCTTCATCTCGAGATGAAGGGCTTGAAGGTCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011971.2-481s1c1
Sequence:CCGGCTCCGAACAAATGTATGGGATCTCGAGATCCCATACATTTGTTCGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011971.2-250s1c1
Sequence:CCGGGCGTCTCAAGTTCCGACTGAACTCGAGTTCAGTCGGAACTTGAGACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011971.4-164s21c1
Sequence:CCGGCGGACTTCCAGAAGATCTTTCCTCGAGGAAAGATCTTCTGGAAGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011971.2-266s1c1
Sequence:CCGGCTGAACTTGTATGAGCTGAAACTCGAGTTTCAGCTCATACAAGTTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011971.4-118s21c1
Sequence:CCGGATCGCTGCAGACAGACGTTTCCTCGAGGAAACGTCTGTCTGCAGCGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)