EMAIL THIS PAGE TO A FRIEND

PSMB4

proteasome (prosome, macropain) subunit, beta type, 4

47 Gene Product Result for
Synonyms: HN3 HsN3 PROS-26 PROS26
UniProtKB ID: P28070, B2R9L3, P31148, Q5SZS5, Q6IBI4, Q969L6
Gene ID:
Human(5692) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. [provided by RefSeq, Jul 2008]
Mouse(19172) proteasome (prosome, macropain) subunit, beta type 4
Rat(58854) proteasome (prosome, macropain) subunit, beta type 4
Zebrafish(550499) proteasome (prosome, macropain) subunit, beta type, 4
dog(475848) proteasome (prosome, macropain) subunit, beta type, 4
domestic cat(101099992) proteasome (prosome, macropain) subunit, beta type, 4
chicken(429986) proteasome (prosome, macropain) subunit, beta type, 4
domestic guinea pig(100729036) proteasome (prosome, macropain) subunit, beta type, 4
naked mole-rat(101720684) proteasome (prosome, macropain) subunit, beta type, 4
Domestic Rabbit(100328673) proteasome (prosome, macropain) subunit, beta type, 4
cow(506203) proteasome (prosome, macropain) subunit, beta type, 4
sheep(101116188) proteasome (prosome, macropain) subunit, beta type, 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002796 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002796 siRNAs that have been validated in the lab human pricing
NM_031629 Rosetta Predictions rat pricing
NM_008945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002796 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040458 validated 695
1 SASI_Hs01_00040457 validated 394
1 SASI_Hs01_00040459 validated 534
2 SASI_Hs01_00040460 predicted 394
3 SASI_Hs02_00334454 predicted 270
4 SASI_Hs01_00040462 predicted 530
5 SASI_Hs01_00040463 predicted 277
6 SASI_Hs01_00040464 predicted 693
7 SASI_Hs01_00040465 predicted 552
8 SASI_Hs01_00040466 predicted 401
9 SASI_Hs01_00040461 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084698 predicted 304
2 SASI_Rn01_00084700 predicted 366
3 SASI_Rn01_00084701 predicted 257
4 SASI_Rn01_00084702 predicted 248
5 SASI_Rn01_00084703 predicted 379
6 SASI_Rn01_00084704 predicted 403
7 SASI_Rn01_00084705 predicted 287
8 SASI_Rn01_00084706 predicted 358
9 SASI_Rn01_00084707 predicted 269
10 SASI_Rn02_00264934 predicted 239
11 SASI_Rn01_00084699 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149049 predicted 510
2 SASI_Mm01_00149050 predicted 275
3 SASI_Mm01_00149051 predicted 535
4 SASI_Mm01_00149052 predicted 399
5 SASI_Mm01_00149053 predicted 526
6 SASI_Mm01_00149054 predicted 521
7 SASI_Mm01_00149055 predicted 328
8 SASI_Mm01_00149056 predicted 261
9 SASI_Mm01_00149057 predicted 669
10 SASI_Mm01_00149058 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008945
VALIDATED
PSMB4 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008945.2-410s21c1
Sequence:CCGGGCCCTAGAGCTATTCATTCATCTCGAGATGAATGAATAGCTCTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008945.1-270s1c1
Sequence:CCGGCCGCAATATCTCTCGTATTATCTCGAGATAATACGAGAGATATTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008945.1-706s1c1
Sequence:CCGGCGTTCGTATAACCGGTTTCAACTCGAGTTGAAACCGGTTATACGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008945.1-413s1c1
Sequence:CCGGGCCCTAGAGCTATTCATTCATCTCGAGATGAATGAATAGCTCTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008945.1-333s1c1
Sequence:CCGGCGCTGATTTCCAGTATTTGAACTCGAGTTCAAATACTGGAAATCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008945.1-526s1c1
Sequence:CCGGCTCGGTTATGTGGACATGCTTCTCGAGAAGCATGTCCACATAACCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008945.2-703s21c1
Sequence:CCGGCGTTCGTATAACCGGTTTCAACTCGAGTTGAAACCGGTTATACGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008945.2-330s21c1
Sequence:CCGGCGCTGATTTCCAGTATTTGAACTCGAGTTCAAATACTGGAAATCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008945.2-267s21c1
Sequence:CCGGCCGCAATATCTCTCGTATTATCTCGAGATAATACGAGAGATATTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008945
VALIDATED
PSMB4 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008945.2-410s21c1
Sequence:CCGGGCCCTAGAGCTATTCATTCATCTCGAGATGAATGAATAGCTCTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008945.1-270s1c1
Sequence:CCGGCCGCAATATCTCTCGTATTATCTCGAGATAATACGAGAGATATTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008945.1-706s1c1
Sequence:CCGGCGTTCGTATAACCGGTTTCAACTCGAGTTGAAACCGGTTATACGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008945.1-413s1c1
Sequence:CCGGGCCCTAGAGCTATTCATTCATCTCGAGATGAATGAATAGCTCTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008945.1-333s1c1
Sequence:CCGGCGCTGATTTCCAGTATTTGAACTCGAGTTCAAATACTGGAAATCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008945.1-526s1c1
Sequence:CCGGCTCGGTTATGTGGACATGCTTCTCGAGAAGCATGTCCACATAACCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008945.2-703s21c1
Sequence:CCGGCGTTCGTATAACCGGTTTCAACTCGAGTTGAAACCGGTTATACGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008945.2-330s21c1
Sequence:CCGGCGCTGATTTCCAGTATTTGAACTCGAGTTCAAATACTGGAAATCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008945.2-267s21c1
Sequence:CCGGCCGCAATATCTCTCGTATTATCTCGAGATAATACGAGAGATATTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008945
VALIDATED
PSMB4 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008945.2-410s21c1
Sequence:CCGGGCCCTAGAGCTATTCATTCATCTCGAGATGAATGAATAGCTCTAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008945.1-270s1c1
Sequence:CCGGCCGCAATATCTCTCGTATTATCTCGAGATAATACGAGAGATATTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008945.1-706s1c1
Sequence:CCGGCGTTCGTATAACCGGTTTCAACTCGAGTTGAAACCGGTTATACGAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008945.1-413s1c1
Sequence:CCGGGCCCTAGAGCTATTCATTCATCTCGAGATGAATGAATAGCTCTAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008945.1-333s1c1
Sequence:CCGGCGCTGATTTCCAGTATTTGAACTCGAGTTCAAATACTGGAAATCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008945.1-526s1c1
Sequence:CCGGCTCGGTTATGTGGACATGCTTCTCGAGAAGCATGTCCACATAACCGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008945.2-703s21c1
Sequence:CCGGCGTTCGTATAACCGGTTTCAACTCGAGTTGAAACCGGTTATACGAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008945.2-330s21c1
Sequence:CCGGCGCTGATTTCCAGTATTTGAACTCGAGTTCAAATACTGGAAATCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008945.2-267s21c1
Sequence:CCGGCCGCAATATCTCTCGTATTATCTCGAGATAATACGAGAGATATTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002796
VALIDATED
PSMB4 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002796.2-511s21c1
Sequence:CCGGGAGAGAGCTTCCTCGGTTATGCTCGAGCATAACCGAGGAAGCTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002796.x-745s1c1
Sequence:CCGGGTGTTGAAATAGAGGGACCATCTCGAGATGGTCCCTCTATTTCAACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002796.x-286s1c1
Sequence:CCGGTGCGAGTCAACAACAGTACCACTCGAGTGGTACTGTTGTTGACTCGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002796.x-266s1c1
Sequence:CCGGCCGCAACATCTCTCGCATTATCTCGAGATAATGCGAGAGATGTTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002796.2-286s21c1
Sequence:CCGGTGCGAGTCAACAACAGTACCACTCGAGTGGTACTGTTGTTGACTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002796.2-690s21c1
Sequence:CCGGTACCGAGATGCCCGTTCTTACCTCGAGGTAAGAACGGGCATCTCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002796.2-317s21c1
Sequence:CCGGCTCTGGCGACTACGCTGATTTCTCGAGAAATCAGCGTAGTCGCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002796.2-266s21c1
Sequence:CCGGCCGCAACATCTCTCGCATTATCTCGAGATAATGCGAGAGATGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002796
VALIDATED
PSMB4 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002796.2-511s21c1
Sequence:CCGGGAGAGAGCTTCCTCGGTTATGCTCGAGCATAACCGAGGAAGCTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002796.x-745s1c1
Sequence:CCGGGTGTTGAAATAGAGGGACCATCTCGAGATGGTCCCTCTATTTCAACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002796.x-286s1c1
Sequence:CCGGTGCGAGTCAACAACAGTACCACTCGAGTGGTACTGTTGTTGACTCGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002796.x-266s1c1
Sequence:CCGGCCGCAACATCTCTCGCATTATCTCGAGATAATGCGAGAGATGTTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002796.2-286s21c1
Sequence:CCGGTGCGAGTCAACAACAGTACCACTCGAGTGGTACTGTTGTTGACTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002796.2-690s21c1
Sequence:CCGGTACCGAGATGCCCGTTCTTACCTCGAGGTAAGAACGGGCATCTCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002796.2-317s21c1
Sequence:CCGGCTCTGGCGACTACGCTGATTTCTCGAGAAATCAGCGTAGTCGCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002796.2-266s21c1
Sequence:CCGGCCGCAACATCTCTCGCATTATCTCGAGATAATGCGAGAGATGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002796
VALIDATED
PSMB4 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002796.2-511s21c1
Sequence:CCGGGAGAGAGCTTCCTCGGTTATGCTCGAGCATAACCGAGGAAGCTCTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002796.x-745s1c1
Sequence:CCGGGTGTTGAAATAGAGGGACCATCTCGAGATGGTCCCTCTATTTCAACACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002796.x-286s1c1
Sequence:CCGGTGCGAGTCAACAACAGTACCACTCGAGTGGTACTGTTGTTGACTCGCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002796.x-266s1c1
Sequence:CCGGCCGCAACATCTCTCGCATTATCTCGAGATAATGCGAGAGATGTTGCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002796.2-286s21c1
Sequence:CCGGTGCGAGTCAACAACAGTACCACTCGAGTGGTACTGTTGTTGACTCGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002796.2-690s21c1
Sequence:CCGGTACCGAGATGCCCGTTCTTACCTCGAGGTAAGAACGGGCATCTCGGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002796.2-317s21c1
Sequence:CCGGCTCTGGCGACTACGCTGATTTCTCGAGAAATCAGCGTAGTCGCCAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002796.2-266s21c1
Sequence:CCGGCCGCAACATCTCTCGCATTATCTCGAGATAATGCGAGAGATGTTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)