EMAIL THIS PAGE TO A FRIEND

PSMB5

proteasome (prosome, macropain) subunit, beta type, 5

67 Gene Product Result for
Synonyms: LMPX MB1 X
Gene ID:
Human(5693) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Mouse(19173) proteasome (prosome, macropain) subunit, beta type 5
Rat(29425) proteasome (prosome, macropain) subunit, beta type 5
cow(534640) proteasome (prosome, macropain) subunit, beta type, 5
sheep(101123468) proteasome (prosome, macropain) subunit, beta type, 5
naked mole-rat(101720045) proteasome (prosome, macropain) subunit, beta type, 5
domestic guinea pig(100730381) proteasome (prosome, macropain) subunit, beta type, 5
Zebrafish(30387) proteasome (prosome, macropain) subunit, beta type, 5
dog(480246) proteasome (prosome, macropain) subunit, beta type, 5
domestic cat(101092368) proteasome (prosome, macropain) subunit, beta type, 5
chicken(396003) proteasome (prosome, macropain) subunit, beta type, 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002797 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002797 siRNAs that have been validated in the lab human pricing
NM_001105727 Rosetta Predictions rat pricing
NM_011186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002797 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076892 validated 544
1 SASI_Hs01_00076894 validated 445
1 SASI_Hs01_00076893 validated 248
2 SASI_Hs02_00334455 predicted 523
3 SASI_Hs01_00076895 predicted 679
4 SASI_Hs01_00076896 predicted 566
5 SASI_Hs01_00076897 predicted 288
6 SASI_Hs01_00076899 predicted 343
7 SASI_Hs02_00334456 predicted 262
8 SASI_Hs01_00076900 predicted 384
9 SASI_Hs01_00076901 predicted 367
10 SASI_Hs01_00076898 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211936 predicted 607
2 SASI_Rn02_00211937 predicted 219
3 SASI_Rn02_00211938 predicted 508
4 SASI_Rn02_00211939 predicted 476
5 SASI_Rn02_00211940 predicted 434
6 SASI_Rn02_00211941 predicted 284
7 SASI_Rn02_00211942 predicted 364
8 SASI_Rn02_00211943 predicted 617
9 SASI_Rn02_00211944 predicted 603
10 SASI_Rn02_00211945 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043312 predicted 268
2 SASI_Mm01_00043315 predicted 211
3 SASI_Mm02_00320083 predicted 428
4 SASI_Mm02_00320084 predicted 213
5 SASI_Mm01_00043318 predicted 368
6 SASI_Mm02_00320085 predicted 358
7 SASI_Mm02_00320086 predicted 253
8 SASI_Mm02_00320087 predicted 367
9 SASI_Mm01_00043310 predicted 605
10 SASI_Mm01_00043311 predicted 584
11 SASI_Mm01_00043313 predicted 467
12 SASI_Mm01_00043314 predicted 609
13 SASI_Mm01_00043316 predicted 545
14 SASI_Mm01_00043317 predicted 430
15 SASI_Mm01_00043319 predicted 575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002797
PSMB5 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002797.3-525s21c1
Sequence:CCGGCCAGACGGTGAAGAAGGTGATCTCGAGATCACCTTCTTCACCGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002797.3-625s21c1
Sequence:CCGGCAATGTCGAATCTATGAGCTTCTCGAGAAGCTCATAGATTCGACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002797.x-401s1c1
Sequence:CCGGCGAAATAAGGAACGCATCTCTCTCGAGAGAGATGCGTTCCTTATTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002797.x-380s1c1
Sequence:CCGGCAATGTCGAATCTATGAGCTTCTCGAGAAGCTCATAGATTCGACATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002797.3-829s21c1
Sequence:CCGGTCTGGCTCTGTGTATGCATATCTCGAGATATGCATACACAGAGCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002797.x-877s1c1
Sequence:CCGGCCCATCCTCCATCCTATTTATCTCGAGATAAATAGGATGGAGGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002797.x-280s1c1
Sequence:CCGGCCAGACGGTGAAGAAGGTGATCTCGAGATCACCTTCTTCACCGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002797.x-584s1c1
Sequence:CCGGTCTGGCTCTGTGTATGCATATCTCGAGATATGCATACACAGAGCCAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002797
PSMB5 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002797.3-525s21c1
Sequence:CCGGCCAGACGGTGAAGAAGGTGATCTCGAGATCACCTTCTTCACCGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002797.3-625s21c1
Sequence:CCGGCAATGTCGAATCTATGAGCTTCTCGAGAAGCTCATAGATTCGACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002797.x-401s1c1
Sequence:CCGGCGAAATAAGGAACGCATCTCTCTCGAGAGAGATGCGTTCCTTATTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002797.x-380s1c1
Sequence:CCGGCAATGTCGAATCTATGAGCTTCTCGAGAAGCTCATAGATTCGACATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002797.3-829s21c1
Sequence:CCGGTCTGGCTCTGTGTATGCATATCTCGAGATATGCATACACAGAGCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002797.x-877s1c1
Sequence:CCGGCCCATCCTCCATCCTATTTATCTCGAGATAAATAGGATGGAGGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002797.x-280s1c1
Sequence:CCGGCCAGACGGTGAAGAAGGTGATCTCGAGATCACCTTCTTCACCGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002797.x-584s1c1
Sequence:CCGGTCTGGCTCTGTGTATGCATATCTCGAGATATGCATACACAGAGCCAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002797
PSMB5 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002797.3-525s21c1
Sequence:CCGGCCAGACGGTGAAGAAGGTGATCTCGAGATCACCTTCTTCACCGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002797.3-625s21c1
Sequence:CCGGCAATGTCGAATCTATGAGCTTCTCGAGAAGCTCATAGATTCGACATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002797.x-401s1c1
Sequence:CCGGCGAAATAAGGAACGCATCTCTCTCGAGAGAGATGCGTTCCTTATTTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002797.x-380s1c1
Sequence:CCGGCAATGTCGAATCTATGAGCTTCTCGAGAAGCTCATAGATTCGACATTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002797.3-829s21c1
Sequence:CCGGTCTGGCTCTGTGTATGCATATCTCGAGATATGCATACACAGAGCCAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002797.x-877s1c1
Sequence:CCGGCCCATCCTCCATCCTATTTATCTCGAGATAAATAGGATGGAGGATGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002797.x-280s1c1
Sequence:CCGGCCAGACGGTGAAGAAGGTGATCTCGAGATCACCTTCTTCACCGTCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002797.x-584s1c1
Sequence:CCGGTCTGGCTCTGTGTATGCATATCTCGAGATATGCATACACAGAGCCAGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011186
VALIDATED
PSMB5 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 5
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-382s21c2
Sequence:CCGGGCTTCGCAATAAGGAACGCATCTCGAGATGCGTTCCTTATTGCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-243s21c1
Sequence:CCGGCAGCAGGTGCTTATATTGCTTCTCGAGAAGCAATATAAGCACCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-371s1c1
Sequence:CCGGCGAATCTATGAGCTTCGCAATCTCGAGATTGCGAAGCTCATAGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-265s1c1
Sequence:CCGGCCAGACGGTGAAGAAAGTAATCTCGAGATTACTTTCTTCACCGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-427s1c1
Sequence:CCGGGCTCGCTAACATGGTGTATCACTCGAGTGATACACCATGTTAGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-382s1c1
Sequence:CCGGGCTTCGCAATAAGGAACGCATCTCGAGATGCGTTCCTTATTGCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-365s1c1
Sequence:CCGGCAGTGTCGAATCTATGAGCTTCTCGAGAAGCTCATAGATTCGACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-249s1c1
Sequence:CCGGGTGCTTATATTGCTTCCCAGACTCGAGTCTGGGAAGCAATATAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-418s1c1
Sequence:CCGGCTCCAAACTGCTCGCTAACATCTCGAGATGTTAGCGAGCAGTTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-577s1c1
Sequence:CCGGCGTGTATGCTTACGGCGTTATCTCGAGATAACGCCGTAAGCATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-243s1c1
Sequence:CCGGCAGCAGGTGCTTATATTGCTTCTCGAGAAGCAATATAAGCACCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-371s21c3
Sequence:CCGGCGAATCTATGAGCTTCGCAATCTCGAGATTGCGAAGCTCATAGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-270s1c1
Sequence:CCGGCGGTGAAGAAAGTAATAGAGACTCGAGTCTCTATTACTTTCTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-418s21c1
Sequence:CCGGCTCCAAACTGCTCGCTAACATCTCGAGATGTTAGCGAGCAGTTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-270s21c1
Sequence:CCGGCGGTGAAGAAAGTAATAGAGACTCGAGTCTCTATTACTTTCTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011186
VALIDATED
PSMB5 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 5
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-382s21c2
Sequence:CCGGGCTTCGCAATAAGGAACGCATCTCGAGATGCGTTCCTTATTGCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-243s21c1
Sequence:CCGGCAGCAGGTGCTTATATTGCTTCTCGAGAAGCAATATAAGCACCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-371s1c1
Sequence:CCGGCGAATCTATGAGCTTCGCAATCTCGAGATTGCGAAGCTCATAGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-265s1c1
Sequence:CCGGCCAGACGGTGAAGAAAGTAATCTCGAGATTACTTTCTTCACCGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-427s1c1
Sequence:CCGGGCTCGCTAACATGGTGTATCACTCGAGTGATACACCATGTTAGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-382s1c1
Sequence:CCGGGCTTCGCAATAAGGAACGCATCTCGAGATGCGTTCCTTATTGCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-365s1c1
Sequence:CCGGCAGTGTCGAATCTATGAGCTTCTCGAGAAGCTCATAGATTCGACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-249s1c1
Sequence:CCGGGTGCTTATATTGCTTCCCAGACTCGAGTCTGGGAAGCAATATAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-418s1c1
Sequence:CCGGCTCCAAACTGCTCGCTAACATCTCGAGATGTTAGCGAGCAGTTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-577s1c1
Sequence:CCGGCGTGTATGCTTACGGCGTTATCTCGAGATAACGCCGTAAGCATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-243s1c1
Sequence:CCGGCAGCAGGTGCTTATATTGCTTCTCGAGAAGCAATATAAGCACCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-371s21c3
Sequence:CCGGCGAATCTATGAGCTTCGCAATCTCGAGATTGCGAAGCTCATAGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-270s1c1
Sequence:CCGGCGGTGAAGAAAGTAATAGAGACTCGAGTCTCTATTACTTTCTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-418s21c1
Sequence:CCGGCTCCAAACTGCTCGCTAACATCTCGAGATGTTAGCGAGCAGTTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-270s21c1
Sequence:CCGGCGGTGAAGAAAGTAATAGAGACTCGAGTCTCTATTACTTTCTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011186
VALIDATED
PSMB5 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 5
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-382s21c2
Sequence:CCGGGCTTCGCAATAAGGAACGCATCTCGAGATGCGTTCCTTATTGCGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-243s21c1
Sequence:CCGGCAGCAGGTGCTTATATTGCTTCTCGAGAAGCAATATAAGCACCTGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-371s1c1
Sequence:CCGGCGAATCTATGAGCTTCGCAATCTCGAGATTGCGAAGCTCATAGATTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-265s1c1
Sequence:CCGGCCAGACGGTGAAGAAAGTAATCTCGAGATTACTTTCTTCACCGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-427s1c1
Sequence:CCGGGCTCGCTAACATGGTGTATCACTCGAGTGATACACCATGTTAGCGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-382s1c1
Sequence:CCGGGCTTCGCAATAAGGAACGCATCTCGAGATGCGTTCCTTATTGCGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-365s1c1
Sequence:CCGGCAGTGTCGAATCTATGAGCTTCTCGAGAAGCTCATAGATTCGACACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-249s1c1
Sequence:CCGGGTGCTTATATTGCTTCCCAGACTCGAGTCTGGGAAGCAATATAAGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-418s1c1
Sequence:CCGGCTCCAAACTGCTCGCTAACATCTCGAGATGTTAGCGAGCAGTTTGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-577s1c1
Sequence:CCGGCGTGTATGCTTACGGCGTTATCTCGAGATAACGCCGTAAGCATACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-243s1c1
Sequence:CCGGCAGCAGGTGCTTATATTGCTTCTCGAGAAGCAATATAAGCACCTGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-371s21c3
Sequence:CCGGCGAATCTATGAGCTTCGCAATCTCGAGATTGCGAAGCTCATAGATTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011186.1-270s1c1
Sequence:CCGGCGGTGAAGAAAGTAATAGAGACTCGAGTCTCTATTACTTTCTTCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-418s21c1
Sequence:CCGGCTCCAAACTGCTCGCTAACATCTCGAGATGTTAGCGAGCAGTTTGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011186.1-270s21c1
Sequence:CCGGCGGTGAAGAAAGTAATAGAGACTCGAGTCTCTATTACTTTCTTCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)