EMAIL THIS PAGE TO A FRIEND

PSMB6

proteasome (prosome, macropain) subunit, beta type, 6

63 Gene Product Result for
Synonyms: DELTA LMPY Y
UniProtKB ID: P28072, Q96J55
Gene ID:
Human(5694) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. The encoded protein is a member of the proteasome B-type family, also known as the T1B family, and is a 20S core beta subunit in the proteasome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(19175) proteasome (prosome, macropain) subunit, beta type 6
Rat(29666) proteasome (prosome, macropain) subunit, beta type 6
cow(510069) proteasome (prosome, macropain) subunit, beta type, 6
sheep(101110950) proteasome (prosome, macropain) subunit, beta type, 6
domestic guinea pig(100720952) proteasome (prosome, macropain) subunit, beta type, 6
naked mole-rat(101712906) proteasome (prosome, macropain) subunit, beta type, 6
Zebrafish(30388) proteasome (prosome, macropain) subunit, beta type, 6
domestic cat(101091823) proteasome (prosome, macropain) subunit, beta type, 6
dog(607466) proteasome (prosome, macropain) subunit, beta type, 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002798 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002798 siRNAs that have been validated in the lab human pricing
NM_057099 Rosetta Predictions rat pricing
NM_008946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002798 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017705 validated 588
1 SASI_Hs01_00017706 validated 532
1 SASI_Hs01_00017704 validated 207
2 SASI_Hs01_00017707 predicted 376
3 SASI_Hs01_00017708 predicted 230
4 SASI_Hs01_00017709 predicted 599
5 SASI_Hs02_00334457 predicted 569
6 SASI_Hs01_00017710 predicted 200
7 SASI_Hs01_00017711 predicted 370
8 SASI_Hs01_00017712 predicted 385
9 SASI_Hs01_00017713 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056171 predicted 309
2 SASI_Rn01_00056173 predicted 272
3 SASI_Rn01_00056176 predicted 228
4 SASI_Rn01_00056177 predicted 285
5 SASI_Rn01_00056178 predicted 296
6 SASI_Rn02_00267023 predicted 267
7 SASI_Rn02_00267024 predicted 380
8 SASI_Rn02_00267025 predicted 440
9 SASI_Rn02_00267026 predicted 503
10 SASI_Rn01_00056174 predicted 287
11 SASI_Rn01_00056172 predicted 252
12 SASI_Rn01_00056175 predicted 293
13 SASI_Rn01_00056179 predicted 219
14 SASI_Rn01_00056180 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199982 predicted 489
2 SASI_Mm01_00199983 predicted 481
3 SASI_Mm02_00314996 predicted 206
4 SASI_Mm01_00199976 predicted 500
5 SASI_Mm02_00314997 predicted 316
6 SASI_Mm02_00314998 predicted 554
7 SASI_Mm02_00314999 predicted 548
8 SASI_Mm01_00199978 predicted 507
9 SASI_Mm02_00315000 predicted 420
10 SASI_Mm02_00315001 predicted 447
11 SASI_Mm01_00199975 predicted 354
12 SASI_Mm01_00199977 predicted 505
13 SASI_Mm01_00199979 predicted 509
14 SASI_Mm01_00199980 predicted 205
15 SASI_Mm01_00199981 predicted 373
16 SASI_Mm01_00199984 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002798
VALIDATED
PSMB6 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002798.1-773s21c1
Sequence:CCGGCAATAAGAGATGCCCTGTACTCTCGAGAGTACAGGGCATCTCTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002798.x-565s1c1
Sequence:CCGGCGGGAAGGCATGACCAAGGAACTCGAGTTCCTTGGTCATGCCTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002798.x-773s1c1
Sequence:CCGGCAATAAGAGATGCCCTGTACTCTCGAGAGTACAGGGCATCTCTTATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002798.x-226s1c1
Sequence:CCGGACTGACAAGCTGACACCTATTCTCGAGAATAGGTGTCAGCTTGTCAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002798.x-238s1c1
Sequence:CCGGACACCTATTCACGACCGCATTCTCGAGAATGCGGTCGTGAATAGGTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002798.x-712s1c1
Sequence:CCGGCAGATACCCAAATTCGCCGTTCTCGAGAACGGCGAATTTGGGTATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_002798.1-565s21c1
Sequence:CCGGCGGGAAGGCATGACCAAGGAACTCGAGTTCCTTGGTCATGCCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002798.1-238s21c1
Sequence:CCGGACACCTATTCACGACCGCATTCTCGAGAATGCGGTCGTGAATAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002798.1-226s21c1
Sequence:CCGGACTGACAAGCTGACACCTATTCTCGAGAATAGGTGTCAGCTTGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002798
VALIDATED
PSMB6 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002798.1-773s21c1
Sequence:CCGGCAATAAGAGATGCCCTGTACTCTCGAGAGTACAGGGCATCTCTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002798.x-565s1c1
Sequence:CCGGCGGGAAGGCATGACCAAGGAACTCGAGTTCCTTGGTCATGCCTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002798.x-773s1c1
Sequence:CCGGCAATAAGAGATGCCCTGTACTCTCGAGAGTACAGGGCATCTCTTATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002798.x-226s1c1
Sequence:CCGGACTGACAAGCTGACACCTATTCTCGAGAATAGGTGTCAGCTTGTCAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002798.x-238s1c1
Sequence:CCGGACACCTATTCACGACCGCATTCTCGAGAATGCGGTCGTGAATAGGTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002798.x-712s1c1
Sequence:CCGGCAGATACCCAAATTCGCCGTTCTCGAGAACGGCGAATTTGGGTATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_002798.1-565s21c1
Sequence:CCGGCGGGAAGGCATGACCAAGGAACTCGAGTTCCTTGGTCATGCCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002798.1-238s21c1
Sequence:CCGGACACCTATTCACGACCGCATTCTCGAGAATGCGGTCGTGAATAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002798.1-226s21c1
Sequence:CCGGACTGACAAGCTGACACCTATTCTCGAGAATAGGTGTCAGCTTGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002798
VALIDATED
PSMB6 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002798.1-773s21c1
Sequence:CCGGCAATAAGAGATGCCCTGTACTCTCGAGAGTACAGGGCATCTCTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002798.x-565s1c1
Sequence:CCGGCGGGAAGGCATGACCAAGGAACTCGAGTTCCTTGGTCATGCCTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002798.x-773s1c1
Sequence:CCGGCAATAAGAGATGCCCTGTACTCTCGAGAGTACAGGGCATCTCTTATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002798.x-226s1c1
Sequence:CCGGACTGACAAGCTGACACCTATTCTCGAGAATAGGTGTCAGCTTGTCAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002798.x-238s1c1
Sequence:CCGGACACCTATTCACGACCGCATTCTCGAGAATGCGGTCGTGAATAGGTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002798.x-712s1c1
Sequence:CCGGCAGATACCCAAATTCGCCGTTCTCGAGAACGGCGAATTTGGGTATCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_002798.1-565s21c1
Sequence:CCGGCGGGAAGGCATGACCAAGGAACTCGAGTTCCTTGGTCATGCCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002798.1-238s21c1
Sequence:CCGGACACCTATTCACGACCGCATTCTCGAGAATGCGGTCGTGAATAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002798.1-226s21c1
Sequence:CCGGACTGACAAGCTGACACCTATTCTCGAGAATAGGTGTCAGCTTGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008946
VALIDATED
PSMB6 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008946.2-304s1c1
Sequence:CCGGGAACTGAACGAGCCTCCACTACTCGAGTAGTGGAGGCTCGTTCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008946.2-336s1c1
Sequence:CCGGCGCCAGTCTCTTTAAGGAGATCTCGAGATCTCCTTAAAGAGACTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008946.2-493s1c1
Sequence:CCGGAGCTCGTACATCTATGGCTATCTCGAGATAGCCATAGATGTACGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008946.2-156s1c1
Sequence:CCGGGACAACCACTGGGTCCTACATCTCGAGATGTAGGACCCAGTGGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008946.2-543s1c1
Sequence:CCGGCAAGGACGAATGTCTGCAGTTCTCGAGAACTGCAGACATTCGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008946
VALIDATED
PSMB6 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008946.2-304s1c1
Sequence:CCGGGAACTGAACGAGCCTCCACTACTCGAGTAGTGGAGGCTCGTTCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008946.2-336s1c1
Sequence:CCGGCGCCAGTCTCTTTAAGGAGATCTCGAGATCTCCTTAAAGAGACTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008946.2-493s1c1
Sequence:CCGGAGCTCGTACATCTATGGCTATCTCGAGATAGCCATAGATGTACGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008946.2-156s1c1
Sequence:CCGGGACAACCACTGGGTCCTACATCTCGAGATGTAGGACCCAGTGGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008946.2-543s1c1
Sequence:CCGGCAAGGACGAATGTCTGCAGTTCTCGAGAACTGCAGACATTCGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008946
VALIDATED
PSMB6 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008946.2-304s1c1
Sequence:CCGGGAACTGAACGAGCCTCCACTACTCGAGTAGTGGAGGCTCGTTCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008946.2-336s1c1
Sequence:CCGGCGCCAGTCTCTTTAAGGAGATCTCGAGATCTCCTTAAAGAGACTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008946.2-493s1c1
Sequence:CCGGAGCTCGTACATCTATGGCTATCTCGAGATAGCCATAGATGTACGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008946.2-156s1c1
Sequence:CCGGGACAACCACTGGGTCCTACATCTCGAGATGTAGGACCCAGTGGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008946.2-543s1c1
Sequence:CCGGCAAGGACGAATGTCTGCAGTTCTCGAGAACTGCAGACATTCGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)