EMAIL THIS PAGE TO A FRIEND

PSMB7

proteasome (prosome, macropain) subunit, beta type, 7

60 Gene Product Result for
Synonyms: Z
UniProtKB ID: Q99436, Q5TBG6, Q96AG8, Q9BWA7
Gene ID:
Human(5695) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. The encoded protein is a member of the proteasome B-type family, also known as the T1B family, and is a 20S core beta subunit in the proteasome. Expression of this catalytic subunit is downregulated by gamma interferon, and proteolytic processing is required to generate a mature subunit. A pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Jul 2012]
Mouse(19177) proteasome (prosome, macropain) subunit, beta type 7
Rat(85492) proteasome (prosome, macropain) subunit, beta type 7
cow(511207) proteasome (prosome, macropain) subunit, beta type, 7
sheep(100135690) proteasome (prosome, macropain) subunit, beta type, 7
naked mole-rat(101719491) proteasome (prosome, macropain) subunit, beta type, 7
domestic guinea pig(100735002) proteasome (prosome, macropain) subunit, beta type, 7
Zebrafish(64278) proteasome (prosome, macropain) subunit, beta type, 7
domestic cat(101081009) proteasome (prosome, macropain) subunit, beta type, 7
dog(100686423) proteasome (prosome, macropain) subunit, beta type, 7
chicken(378915) proteasome (prosome, macropain) subunit, beta type, 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002799 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002799 Rosetta Predictions human pricing
NM_053532 Rosetta Predictions rat pricing
NM_011187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241662 predicted 592
2 SASI_Hs02_00334458 predicted 240
3 SASI_Hs01_00241667 predicted 375
4 SASI_Hs02_00334459 predicted 218
5 SASI_Hs01_00241669 predicted 299
6 SASI_Hs02_00334460 predicted 700
7 SASI_Hs01_00241661 predicted 208
8 SASI_Hs01_00241663 predicted 495
9 SASI_Hs01_00241664 predicted 461
10 SASI_Hs01_00241665 predicted 480
11 SASI_Hs01_00241666 predicted 514
12 SASI_Hs01_00241668 predicted 409
13 SASI_Hs01_00241670 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075560 predicted 588
2 SASI_Rn01_00075561 predicted 462
3 SASI_Rn01_00075562 predicted 605
4 SASI_Rn01_00075563 predicted 362
5 SASI_Rn01_00075566 predicted 682
6 SASI_Rn01_00075567 predicted 467
7 SASI_Rn01_00075568 predicted 409
8 SASI_Rn01_00075569 predicted 354
9 SASI_Rn02_00266150 predicted 480
10 SASI_Rn02_00266151 predicted 538
11 SASI_Rn01_00075564 predicted 683
12 SASI_Rn01_00075565 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320088 predicted 389
2 SASI_Mm02_00320089 predicted 356
3 SASI_Mm02_00320090 predicted 194
4 SASI_Mm02_00320091 predicted 235
5 SASI_Mm02_00320092 predicted 367
6 SASI_Mm02_00320093 predicted 238
7 SASI_Mm02_00320094 predicted 563
8 SASI_Mm02_00320095 predicted 530
9 SASI_Mm02_00320096 predicted 601
10 SASI_Mm02_00320097 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002799
VALIDATED
PSMB7 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-424s1c1
Sequence:CCGGACATTGGTGCAGCCCTAGTTTCTCGAGAAACTAGGGCTGCACCAATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-893s1c1
Sequence:CCGGGAGCATTGAGGCCCAGTAAGACTCGAGTCTTACTGGGCCTCAATGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-296s1c1
Sequence:CCGGAGACACAGACATGACAACCCACTCGAGTGGGTTGTCATGTCTGTGTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-471s1c1
Sequence:CCGGCACCTCTACAGCATCTATCCTCTCGAGAGGATAGATGCTGTAGAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-804s1c1
Sequence:CCGGGAGATTGAGGTGCTGGAAGAACTCGAGTTCTTCCAGCACCTCAATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002799.2-893s21c1
Sequence:CCGGGAGCATTGAGGCCCAGTAAGACTCGAGTCTTACTGGGCCTCAATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002799.2-83s21c1
Sequence:CCGGTGCCGTCTTGGAAGCCGATTTCTCGAGAAATCGGCTTCCAAGACGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002799.2-804s21c1
Sequence:CCGGGAGATTGAGGTGCTGGAAGAACTCGAGTTCTTCCAGCACCTCAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002799.2-471s21c1
Sequence:CCGGCACCTCTACAGCATCTATCCTCTCGAGAGGATAGATGCTGTAGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002799.2-424s21c1
Sequence:CCGGACATTGGTGCAGCCCTAGTTTCTCGAGAAACTAGGGCTGCACCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002799
VALIDATED
PSMB7 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-424s1c1
Sequence:CCGGACATTGGTGCAGCCCTAGTTTCTCGAGAAACTAGGGCTGCACCAATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-893s1c1
Sequence:CCGGGAGCATTGAGGCCCAGTAAGACTCGAGTCTTACTGGGCCTCAATGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-296s1c1
Sequence:CCGGAGACACAGACATGACAACCCACTCGAGTGGGTTGTCATGTCTGTGTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-471s1c1
Sequence:CCGGCACCTCTACAGCATCTATCCTCTCGAGAGGATAGATGCTGTAGAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-804s1c1
Sequence:CCGGGAGATTGAGGTGCTGGAAGAACTCGAGTTCTTCCAGCACCTCAATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002799.2-893s21c1
Sequence:CCGGGAGCATTGAGGCCCAGTAAGACTCGAGTCTTACTGGGCCTCAATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002799.2-83s21c1
Sequence:CCGGTGCCGTCTTGGAAGCCGATTTCTCGAGAAATCGGCTTCCAAGACGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002799.2-804s21c1
Sequence:CCGGGAGATTGAGGTGCTGGAAGAACTCGAGTTCTTCCAGCACCTCAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002799.2-471s21c1
Sequence:CCGGCACCTCTACAGCATCTATCCTCTCGAGAGGATAGATGCTGTAGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002799.2-424s21c1
Sequence:CCGGACATTGGTGCAGCCCTAGTTTCTCGAGAAACTAGGGCTGCACCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002799
VALIDATED
PSMB7 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-424s1c1
Sequence:CCGGACATTGGTGCAGCCCTAGTTTCTCGAGAAACTAGGGCTGCACCAATGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-893s1c1
Sequence:CCGGGAGCATTGAGGCCCAGTAAGACTCGAGTCTTACTGGGCCTCAATGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-296s1c1
Sequence:CCGGAGACACAGACATGACAACCCACTCGAGTGGGTTGTCATGTCTGTGTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-471s1c1
Sequence:CCGGCACCTCTACAGCATCTATCCTCTCGAGAGGATAGATGCTGTAGAGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002799.x-804s1c1
Sequence:CCGGGAGATTGAGGTGCTGGAAGAACTCGAGTTCTTCCAGCACCTCAATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002799.2-893s21c1
Sequence:CCGGGAGCATTGAGGCCCAGTAAGACTCGAGTCTTACTGGGCCTCAATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002799.2-83s21c1
Sequence:CCGGTGCCGTCTTGGAAGCCGATTTCTCGAGAAATCGGCTTCCAAGACGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002799.2-804s21c1
Sequence:CCGGGAGATTGAGGTGCTGGAAGAACTCGAGTTCTTCCAGCACCTCAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002799.2-471s21c1
Sequence:CCGGCACCTCTACAGCATCTATCCTCTCGAGAGGATAGATGCTGTAGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002799.2-424s21c1
Sequence:CCGGACATTGGTGCAGCCCTAGTTTCTCGAGAAACTAGGGCTGCACCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011187
PSMB7 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-539s1c1
Sequence:CCGGGCTGTGTTTGAAGATAAGTTTCTCGAGAAACTTATCTTCAAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-440s1c1
Sequence:CCGGGTAGATGTTACTGGACCTCATCTCGAGATGAGGTCCAGTAACATCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-191s1c1
Sequence:CCGGGCAACTGAAGGGATGGTTGTTCTCGAGAACAACCATCCCTTCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-644s1c1
Sequence:CCGGAGCAACATTGATCTGTGTGTTCTCGAGAACACACAGATCAATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-797s1c1
Sequence:CCGGGAGGTGCTAGAAGAGACTGTTCTCGAGAACAGTCTCTTCTAGCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011187
PSMB7 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-539s1c1
Sequence:CCGGGCTGTGTTTGAAGATAAGTTTCTCGAGAAACTTATCTTCAAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-440s1c1
Sequence:CCGGGTAGATGTTACTGGACCTCATCTCGAGATGAGGTCCAGTAACATCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-191s1c1
Sequence:CCGGGCAACTGAAGGGATGGTTGTTCTCGAGAACAACCATCCCTTCAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-644s1c1
Sequence:CCGGAGCAACATTGATCTGTGTGTTCTCGAGAACACACAGATCAATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-797s1c1
Sequence:CCGGGAGGTGCTAGAAGAGACTGTTCTCGAGAACAGTCTCTTCTAGCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011187
PSMB7 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-539s1c1
Sequence:CCGGGCTGTGTTTGAAGATAAGTTTCTCGAGAAACTTATCTTCAAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-440s1c1
Sequence:CCGGGTAGATGTTACTGGACCTCATCTCGAGATGAGGTCCAGTAACATCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-191s1c1
Sequence:CCGGGCAACTGAAGGGATGGTTGTTCTCGAGAACAACCATCCCTTCAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-644s1c1
Sequence:CCGGAGCAACATTGATCTGTGTGTTCTCGAGAACACACAGATCAATGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011187.1-797s1c1
Sequence:CCGGGAGGTGCTAGAAGAGACTGTTCTCGAGAACAGTCTCTTCTAGCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)