EMAIL THIS PAGE TO A FRIEND

PSMB8

proteasome (prosome, macropain) subunit, beta type, 8

76 Gene Product Result for
Synonyms: ALDD D6S216 D6S216E JMP LMP7 NKJO PSMB5i RING10
UniProtKB ID: P28062, B0UZC0, Q29824, Q5JNW6, Q5QNR8, Q96J48
Gene ID:
Human(5696) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 3 (proteasome beta 5 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. Two alternative transcripts encoding two isoforms have been identified; both isoforms are processed to yield the same mature subunit. [provided by RefSeq, Jul 2008]
Mouse(16913) proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7)
Rat(24968) proteasome (prosome, macropain) subunit, beta type, 8
cow(282013) proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)
sheep(100174905) proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)
Goat(100860993) proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)
domestic guinea pig(100717290) proteasome (prosome, macropain) subunit, beta type, 8
naked mole-rat(101702300) proteasome (prosome, macropain) subunit, beta type, 8
Zebrafish(30666) proteasome (prosome, macropain) subunit, beta type, 8
dog(474865) proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)
domestic cat(101083171) proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501268 Anti-PSMB8 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB1406321 Anti-PSMB8 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA046995 Anti-PSMB8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA050327 Anti-PSMB8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB1411120 Anti-PSMB8 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
WH0005696M1 Monoclonal Anti-PSMB8 antibody produced in mouse clone 1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5300399 Monoclonal Anti-PSMB8 antibody produced in mouse clone 1A5, ascites fluid human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404265 Monoclonal Anti-PSMB8, (C-terminal) antibody produced in mouse clone 1G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004159 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004159 Rosetta Predictions human pricing
NM_148919 Rosetta Predictions human pricing
NM_080767 Rosetta Predictions rat pricing
NM_010724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056686 predicted 1296
2 SASI_Hs01_00056687 predicted 1007
3 SASI_Hs01_00056688 predicted 922
4 SASI_Hs01_00056690 predicted 912
5 SASI_Hs02_00337016 predicted 1046
6 SASI_Hs01_00056691 predicted 903
7 SASI_Hs02_00337017 predicted 954
8 SASI_Hs01_00056692 predicted 1190
9 SASI_Hs01_00056693 predicted 1144
10 SASI_Hs01_00056694 predicted 1209
11 SASI_Hs01_00056685 predicted 1265
12 SASI_Hs01_00056689 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135581 predicted 836
2 SASI_Hs01_00135582 predicted 539
3 SASI_Hs01_00135583 predicted 460
4 SASI_Hs01_00135585 predicted 447
5 SASI_Hs02_00365648 predicted 586
6 SASI_Hs01_00135586 predicted 441
7 SASI_Hs02_00365649 predicted 486
8 SASI_Hs01_00135587 predicted 728
9 SASI_Hs01_00135588 predicted 677
10 SASI_Hs01_00135589 predicted 741
11 SASI_Hs01_00135580 predicted 798
12 SASI_Hs01_00135584 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267291 predicted 233
2 SASI_Rn01_00052124 predicted 741
3 SASI_Rn01_00052125 predicted 289
4 SASI_Rn01_00052127 predicted 380
5 SASI_Rn01_00052128 predicted 227
6 SASI_Rn01_00052129 predicted 309
7 SASI_Rn01_00052130 predicted 769
8 SASI_Rn01_00052131 predicted 385
9 SASI_Rn01_00052132 predicted 387
10 SASI_Rn01_00052133 predicted 728
11 SASI_Rn01_00052126 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049056 predicted 487
2 SASI_Mm01_00049059 predicted 420
3 SASI_Mm02_00319205 predicted 378
4 SASI_Mm02_00319206 predicted 894
5 SASI_Mm02_00319207 predicted 948
6 SASI_Mm02_00319208 predicted 969
7 SASI_Mm02_00319209 predicted 991
8 SASI_Mm02_00319210 predicted 371
9 SASI_Mm01_00049060 predicted 540
10 SASI_Mm02_00319211 predicted 982
11 SASI_Mm01_00049057 predicted 294
12 SASI_Mm01_00049058 predicted 390
13 SASI_Mm01_00049061 predicted 218
14 SASI_Mm01_00049062 predicted 542
15 SASI_Mm01_00049063 predicted 228
16 SASI_Mm01_00049064 predicted 295
17 SASI_Mm01_00049065 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004159
VALIDATED
PSMB8 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004159.3-1042s1c1
Sequence:CCGGGTTGGGTGAAAGTAGAAAGTACTCGAGTACTTTCTACTTTCACCCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004159.3-982s1c1
Sequence:CCGGCCACTCACAGAGACAGCTATTCTCGAGAATAGCTGTCTCTGTGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004159.3-369s1c1
Sequence:CCGGCCTTTAGATGACACGACCCTACTCGAGTAGGGTCGTGTCATCTAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004159.3-776s1c1
Sequence:CCGGCCTCTCTATGGGCAGTATGATCTCGAGATCATACTGCCCATAGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004159.3-1172s1c1
Sequence:CCGGCCACGTTAAGTCCAAGGAGAACTCGAGTTCTCCTTGGACTTAACGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004159.4-1274s21c1
Sequence:CCGGGTTGGGTGAAAGTAGAAAGTACTCGAGTACTTTCTACTTTCACCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004159.4-1404s21c1
Sequence:CCGGCCACGTTAAGTCCAAGGAGAACTCGAGTTCTCCTTGGACTTAACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004159.4-1214s21c1
Sequence:CCGGCCACTCACAGAGACAGCTATTCTCGAGAATAGCTGTCTCTGTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004159.4-1008s21c1
Sequence:CCGGCCTCTCTATGGGCAGTATGATCTCGAGATCATACTGCCCATAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004159
VALIDATED
PSMB8 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004159.3-1042s1c1
Sequence:CCGGGTTGGGTGAAAGTAGAAAGTACTCGAGTACTTTCTACTTTCACCCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004159.3-982s1c1
Sequence:CCGGCCACTCACAGAGACAGCTATTCTCGAGAATAGCTGTCTCTGTGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004159.3-369s1c1
Sequence:CCGGCCTTTAGATGACACGACCCTACTCGAGTAGGGTCGTGTCATCTAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004159.3-776s1c1
Sequence:CCGGCCTCTCTATGGGCAGTATGATCTCGAGATCATACTGCCCATAGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004159.3-1172s1c1
Sequence:CCGGCCACGTTAAGTCCAAGGAGAACTCGAGTTCTCCTTGGACTTAACGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004159.4-1274s21c1
Sequence:CCGGGTTGGGTGAAAGTAGAAAGTACTCGAGTACTTTCTACTTTCACCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004159.4-1404s21c1
Sequence:CCGGCCACGTTAAGTCCAAGGAGAACTCGAGTTCTCCTTGGACTTAACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004159.4-1214s21c1
Sequence:CCGGCCACTCACAGAGACAGCTATTCTCGAGAATAGCTGTCTCTGTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004159.4-1008s21c1
Sequence:CCGGCCTCTCTATGGGCAGTATGATCTCGAGATCATACTGCCCATAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004159
VALIDATED
PSMB8 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004159.3-1042s1c1
Sequence:CCGGGTTGGGTGAAAGTAGAAAGTACTCGAGTACTTTCTACTTTCACCCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004159.3-982s1c1
Sequence:CCGGCCACTCACAGAGACAGCTATTCTCGAGAATAGCTGTCTCTGTGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004159.3-369s1c1
Sequence:CCGGCCTTTAGATGACACGACCCTACTCGAGTAGGGTCGTGTCATCTAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004159.3-776s1c1
Sequence:CCGGCCTCTCTATGGGCAGTATGATCTCGAGATCATACTGCCCATAGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004159.3-1172s1c1
Sequence:CCGGCCACGTTAAGTCCAAGGAGAACTCGAGTTCTCCTTGGACTTAACGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004159.4-1274s21c1
Sequence:CCGGGTTGGGTGAAAGTAGAAAGTACTCGAGTACTTTCTACTTTCACCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004159.4-1404s21c1
Sequence:CCGGCCACGTTAAGTCCAAGGAGAACTCGAGTTCTCCTTGGACTTAACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004159.4-1214s21c1
Sequence:CCGGCCACTCACAGAGACAGCTATTCTCGAGAATAGCTGTCTCTGTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004159.4-1008s21c1
Sequence:CCGGCCTCTCTATGGGCAGTATGATCTCGAGATCATACTGCCCATAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010724
PSMB8 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-282s1c1
Sequence:CCGGAGGGAGTTACATTAGCTCCTTCTCGAGAAGGAGCTAATGTAACTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-541s1c1
Sequence:CCGGCCAGGACTTTACTACGTAGATCTCGAGATCTACGTAGTAAAGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-309s1c1
Sequence:CCGGGAACAAAGTGATCGAGATTAACTCGAGTTAATCTCGATCACTTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-178s1c1
Sequence:CCGGGACCAGGAAAGGAATGTTCAACTCGAGTTGAACATTCCTTTCCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-406s1c1
Sequence:CCGGAGGTTGTATTATCTTCGGAATCTCGAGATTCCGAAGATAATACAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-355s21c1
Sequence:CCGGACCGCATTCCTGAGGTCCTTTCTCGAGAAAGGACCTCAGGAATGCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-975s21c1
Sequence:CCGGGAAAGTGGAGAGTTCCGATGTCTCGAGACATCGGAACTCTCCACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-886s21c1
Sequence:CCGGGGCCGCAGAGCTATTGCTTATCTCGAGATAAGCAATAGCTCTGCGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-808s21c1
Sequence:CCGGAGCGGGAACACCTATGCCTATCTCGAGATAGGCATAGGTGTTCCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-421s21c1
Sequence:CCGGACAACCACACTCGCCTTCAAGCTCGAGCTTGAAGGCGAGTGTGGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010724
PSMB8 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-282s1c1
Sequence:CCGGAGGGAGTTACATTAGCTCCTTCTCGAGAAGGAGCTAATGTAACTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-541s1c1
Sequence:CCGGCCAGGACTTTACTACGTAGATCTCGAGATCTACGTAGTAAAGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-309s1c1
Sequence:CCGGGAACAAAGTGATCGAGATTAACTCGAGTTAATCTCGATCACTTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-178s1c1
Sequence:CCGGGACCAGGAAAGGAATGTTCAACTCGAGTTGAACATTCCTTTCCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-406s1c1
Sequence:CCGGAGGTTGTATTATCTTCGGAATCTCGAGATTCCGAAGATAATACAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-355s21c1
Sequence:CCGGACCGCATTCCTGAGGTCCTTTCTCGAGAAAGGACCTCAGGAATGCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-975s21c1
Sequence:CCGGGAAAGTGGAGAGTTCCGATGTCTCGAGACATCGGAACTCTCCACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-886s21c1
Sequence:CCGGGGCCGCAGAGCTATTGCTTATCTCGAGATAAGCAATAGCTCTGCGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-808s21c1
Sequence:CCGGAGCGGGAACACCTATGCCTATCTCGAGATAGGCATAGGTGTTCCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-421s21c1
Sequence:CCGGACAACCACACTCGCCTTCAAGCTCGAGCTTGAAGGCGAGTGTGGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010724
PSMB8 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-282s1c1
Sequence:CCGGAGGGAGTTACATTAGCTCCTTCTCGAGAAGGAGCTAATGTAACTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-541s1c1
Sequence:CCGGCCAGGACTTTACTACGTAGATCTCGAGATCTACGTAGTAAAGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-309s1c1
Sequence:CCGGGAACAAAGTGATCGAGATTAACTCGAGTTAATCTCGATCACTTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-178s1c1
Sequence:CCGGGACCAGGAAAGGAATGTTCAACTCGAGTTGAACATTCCTTTCCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010724.1-406s1c1
Sequence:CCGGAGGTTGTATTATCTTCGGAATCTCGAGATTCCGAAGATAATACAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-355s21c1
Sequence:CCGGACCGCATTCCTGAGGTCCTTTCTCGAGAAAGGACCTCAGGAATGCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-975s21c1
Sequence:CCGGGAAAGTGGAGAGTTCCGATGTCTCGAGACATCGGAACTCTCCACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-886s21c1
Sequence:CCGGGGCCGCAGAGCTATTGCTTATCTCGAGATAAGCAATAGCTCTGCGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-808s21c1
Sequence:CCGGAGCGGGAACACCTATGCCTATCTCGAGATAGGCATAGGTGTTCCCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010724.2-421s21c1
Sequence:CCGGACAACCACACTCGCCTTCAAGCTCGAGCTTGAAGGCGAGTGTGGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)