EMAIL THIS PAGE TO A FRIEND

PSMB9

proteasome (prosome, macropain) subunit, beta type, 9

58 Gene Product Result for
Synonyms: LMP2 PSMB6i RING12 beta1i
UniProtKB ID: P28065, B0V0T1, Q16523, Q5JNW4
Gene ID:
Human(5698) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 1 (proteasome beta 6 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. [provided by RefSeq, Mar 2010]
Mouse(16912) proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2)
Rat(24967) proteasome (prosome, macropain) subunit, beta type, 9
domestic cat(101083848) proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2)
dog(474867) proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2)
naked mole-rat(101701705) proteasome (prosome, macropain) subunit, beta type, 9
domestic guinea pig(100734835) proteasome (prosome, macropain) subunit, beta type, 9
cow(510593) proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2)
sheep(101115834) proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002800 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002800 Rosetta Predictions human pricing
NM_148954 Rosetta Predictions human pricing
NM_012708 Rosetta Predictions rat pricing
NM_013585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039111 predicted 782
2 SASI_Hs01_00039113 predicted 441
3 SASI_Hs01_00039114 predicted 734
4 SASI_Hs01_00039115 predicted 471
5 SASI_Hs01_00039116 predicted 364
6 SASI_Hs01_00039117 predicted 397
7 SASI_Hs01_00039118 predicted 791
8 SASI_Hs01_00039119 predicted 401
9 SASI_Hs02_00334461 predicted 379
10 SASI_Hs02_00334462 predicted 357
11 SASI_Hs01_00039112 predicted 340
12 SASI_Hs01_00039120 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170473 predicted 748
2 SASI_Hs01_00170475 predicted 407
3 SASI_Hs01_00170476 predicted 698
4 SASI_Hs01_00170477 predicted 438
5 SASI_Hs01_00170478 predicted 333
6 SASI_Hs01_00170479 predicted 368
7 SASI_Hs01_00170480 predicted 760
8 SASI_Hs01_00170481 predicted 380
9 SASI_Hs02_00365663 predicted 355
10 SASI_Hs02_00365664 predicted 333
11 SASI_Hs01_00170474 predicted 305
12 SASI_Hs01_00170482 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109844 predicted 543
2 SASI_Rn01_00109845 predicted 477
3 SASI_Rn01_00109846 predicted 482
4 SASI_Rn01_00109847 predicted 418
5 SASI_Rn01_00109848 predicted 466
6 SASI_Rn01_00109849 predicted 348
7 SASI_Rn01_00109850 predicted 464
8 SASI_Rn01_00109851 predicted 529
9 SASI_Rn01_00109852 predicted 353
10 SASI_Rn01_00109853 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046943 predicted 478
2 SASI_Mm01_00046944 predicted 350
3 SASI_Mm02_00322326 predicted 225
4 SASI_Mm01_00046945 predicted 373
5 SASI_Mm01_00046946 predicted 353
6 SASI_Mm01_00046947 predicted 464
7 SASI_Mm01_00046948 predicted 546
8 SASI_Mm01_00046950 predicted 482
9 SASI_Mm01_00046951 predicted 463
10 SASI_Mm01_00046952 predicted 518
11 SASI_Mm01_00046949 predicted 541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002800
VALIDATED
PSMB9 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002800.4-785s21c1
Sequence:CCGGTGGTATGGTCATTGGGAAATGCTCGAGCATTTCCCAATGACCATACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002800.4-682s21c1
Sequence:CCGGCATCGAGTCATCTTGGGCAATCTCGAGATTGCCCAAGATGACTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002800.4-364s21c1
Sequence:CCGGGCTGCAAATGTGGTGAGAAATCTCGAGATTTCTCACCACATTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002800.4-645s21c1
Sequence:CCGGCATCTACCTGGTCACTATTACCTCGAGGTAATAGTGACCAGGTAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002800.x-741s1c1
Sequence:CCGGGTAATAAACTCTCTAGGGCCACTCGAGTGGCCCTAGAGAGTTTATTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002800.x-664s1c1
Sequence:CCGGCATCGAGTCATCTTGGGCAATCTCGAGATTGCCCAAGATGACTCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002800.x-568s1c1
Sequence:CCGGCGCTTCACCACAGACGCTATTCTCGAGAATAGCGTCTGTGGTGAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002800.x-507s1c1
Sequence:CCGGCTTTATCTATGGTTATGTGGACTCGAGTCCACATAACCATAGATAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002800.x-346s1c1
Sequence:CCGGGCTGCAAATGTGGTGAGAAATCTCGAGATTTCTCACCACATTTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002800.4-586s21c1
Sequence:CCGGCGCTTCACCACAGACGCTATTCTCGAGAATAGCGTCTGTGGTGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002800
VALIDATED
PSMB9 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002800.4-785s21c1
Sequence:CCGGTGGTATGGTCATTGGGAAATGCTCGAGCATTTCCCAATGACCATACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002800.4-682s21c1
Sequence:CCGGCATCGAGTCATCTTGGGCAATCTCGAGATTGCCCAAGATGACTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002800.4-364s21c1
Sequence:CCGGGCTGCAAATGTGGTGAGAAATCTCGAGATTTCTCACCACATTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002800.4-645s21c1
Sequence:CCGGCATCTACCTGGTCACTATTACCTCGAGGTAATAGTGACCAGGTAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002800.x-741s1c1
Sequence:CCGGGTAATAAACTCTCTAGGGCCACTCGAGTGGCCCTAGAGAGTTTATTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002800.x-664s1c1
Sequence:CCGGCATCGAGTCATCTTGGGCAATCTCGAGATTGCCCAAGATGACTCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002800.x-568s1c1
Sequence:CCGGCGCTTCACCACAGACGCTATTCTCGAGAATAGCGTCTGTGGTGAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002800.x-507s1c1
Sequence:CCGGCTTTATCTATGGTTATGTGGACTCGAGTCCACATAACCATAGATAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002800.x-346s1c1
Sequence:CCGGGCTGCAAATGTGGTGAGAAATCTCGAGATTTCTCACCACATTTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002800.4-586s21c1
Sequence:CCGGCGCTTCACCACAGACGCTATTCTCGAGAATAGCGTCTGTGGTGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002800
VALIDATED
PSMB9 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002800.4-785s21c1
Sequence:CCGGTGGTATGGTCATTGGGAAATGCTCGAGCATTTCCCAATGACCATACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002800.4-682s21c1
Sequence:CCGGCATCGAGTCATCTTGGGCAATCTCGAGATTGCCCAAGATGACTCGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002800.4-364s21c1
Sequence:CCGGGCTGCAAATGTGGTGAGAAATCTCGAGATTTCTCACCACATTTGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002800.4-645s21c1
Sequence:CCGGCATCTACCTGGTCACTATTACCTCGAGGTAATAGTGACCAGGTAGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002800.x-741s1c1
Sequence:CCGGGTAATAAACTCTCTAGGGCCACTCGAGTGGCCCTAGAGAGTTTATTACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002800.x-664s1c1
Sequence:CCGGCATCGAGTCATCTTGGGCAATCTCGAGATTGCCCAAGATGACTCGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002800.x-568s1c1
Sequence:CCGGCGCTTCACCACAGACGCTATTCTCGAGAATAGCGTCTGTGGTGAAGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002800.x-507s1c1
Sequence:CCGGCTTTATCTATGGTTATGTGGACTCGAGTCCACATAACCATAGATAAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002800.x-346s1c1
Sequence:CCGGGCTGCAAATGTGGTGAGAAATCTCGAGATTTCTCACCACATTTGCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002800.4-586s21c1
Sequence:CCGGCGCTTCACCACAGACGCTATTCTCGAGAATAGCGTCTGTGGTGAAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013585
VALIDATED
PSMB9 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, beta type, 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013585.1-324s1c1
Sequence:CCGGCGTGGTGAAGAACATCTCCTACTCGAGTAGGAGATGTTCTTCACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013585.1-432s1c1
Sequence:CCGGGATGCTAATTCGACAGCCCTTCTCGAGAAGGGCTGTCGAATTAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013585.1-537s1c1
Sequence:CCGGGCGTTTCACCACAGATGCCATCTCGAGATGGCATCTGTGGTGAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013585.1-472s1c1
Sequence:CCGGAGCTCCTACATTTATGGTTATCTCGAGATAACCATAAATGTAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013585.1-358s1c1
Sequence:CCGGGACTTGTTAGCGCATCTCATACTCGAGTATGAGATGCGCTAACAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013585
VALIDATED
PSMB9 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, beta type, 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013585.1-324s1c1
Sequence:CCGGCGTGGTGAAGAACATCTCCTACTCGAGTAGGAGATGTTCTTCACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013585.1-432s1c1
Sequence:CCGGGATGCTAATTCGACAGCCCTTCTCGAGAAGGGCTGTCGAATTAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013585.1-537s1c1
Sequence:CCGGGCGTTTCACCACAGATGCCATCTCGAGATGGCATCTGTGGTGAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013585.1-472s1c1
Sequence:CCGGAGCTCCTACATTTATGGTTATCTCGAGATAACCATAAATGTAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013585.1-358s1c1
Sequence:CCGGGACTTGTTAGCGCATCTCATACTCGAGTATGAGATGCGCTAACAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013585
VALIDATED
PSMB9 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, beta type, 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013585.1-324s1c1
Sequence:CCGGCGTGGTGAAGAACATCTCCTACTCGAGTAGGAGATGTTCTTCACCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013585.1-432s1c1
Sequence:CCGGGATGCTAATTCGACAGCCCTTCTCGAGAAGGGCTGTCGAATTAGCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013585.1-537s1c1
Sequence:CCGGGCGTTTCACCACAGATGCCATCTCGAGATGGCATCTGTGGTGAAACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013585.1-472s1c1
Sequence:CCGGAGCTCCTACATTTATGGTTATCTCGAGATAACCATAAATGTAGGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013585.1-358s1c1
Sequence:CCGGGACTTGTTAGCGCATCTCATACTCGAGTATGAGATGCGCTAACAAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)